Transcript asmbl_23262

Sequence
Transcript Sequence for observation asmbl_23262 of TGE0004288:
GCTCGTCTGAGGCGGAGGCAGCGCCGCGCCGGACCCGAGTTTCTTTCACTTTCTGGGATTGAATTTTGAGCCATCAAAACCATGAGCAACTACAGCGTGTCCTTGGTTGGTCCTGCTCCTTGGGGTTTCCGGCTGCAAGGTGGCAAAGATTTCAACATGCCTCTGACAATTTCTAGTTTAAAAGATGGCGGCAAAGCCTCCCAGGCGAATGTGAGAATAGGTGATGTGGTTCTCAGCATCGATGGAATAAGCGCCCATGGAATGACTCATCTTGAAGCCCAGAACAAGATTAAGGGTTGTACAGGCTCTTTGAATATGACTCTGCAAAGAGCATCTGCTACACCCAGGCCCGAGCCGGTTCCTGTTCAAAAGGGAGAACCTAAAGAAGTAGTTAAACCTGTACCCATTTCATCTCCTGCTGTGTCCAAAGTCACTTCCACAACCAACATGGCCTACAATAAGACACCACGGCCCTTTGGTTCTATGTCTTCACCAAAAGTCACATCCATCCCATCACCATCGTCCGCCTTCACCCCGGCCCACGCGACCACTTCATCACATGCTTCCCCTCCCGTGGCTGCTGTCACTCCTCCCCCATTCGCTGCATCTGGACTGCATGCTAATGCCAATCTTAGTGCTGACCAGCATTCACCTGCACTGAGCGCTGGTAAACCTGCAGTTAATGTCCCACGGCAGCCCACAGTCACCAGCGTGTGTTCCGAGACTGCTCAGGAGCTAGCAGAGGGACAGAGAAGAGGATCCCAGGGTGACAGTAAACAGCAAAATGGCCCACCGAGAAAACACATTGTGGACCGTAACACGGAGTTTTATCACATACCCACCCACAGCGATGCCAGCAAGAAGAGACTGATTGAGGATACAGAAGACTGGCGTCCGAGGACGGGCACAACGCAGTCTCGCTCTTTTCGAATCCTGGCCCAGATCACTGGGACTGAACATCTGAAAGAATCTGAAACTGATAATACAAAGAAGGCAAACAACACCCAGGAGCCTTCTCAGCATTTGGCTCCATCAGTAGCTTCAGCACGGAGCATGCCTGAGAGGCCAGGAAGCCCAGCCTCTGCCAGACCAGGGGTGGCTGGTCTCACAACTGCTGCTGCCTTCAAGCCTCTAGGATCCACCAGCACCATCAAGTCACCAAGCTGGCAACGGCCAAACCAAGCAGCACCTTACACTGGAAGAATCTCAAATAGTGCAGCTTCCTCAGGAGCAGTGGGACCAGCCGCCTCCTCTGTGGGGCAGCCCCAGCCAAGTGACCAGGACACTTTAGTGCAACGAGCTGAGCACATTCCAGCAGGAAAACGAACTCCAATGTGTGCCCACTGTAACCAGGTCATCAGGGGACCATTTCTAGTGGCACTGGGGAAATCTTGGCACCCAGAAGAATTCAACTGTGCTCACTGCAAAAATACAATGGCCTACATTGGATTTGTGGAGGAAAAGGGGGCCCTGTATTGTGAGCTCTGCTATGAGAAATTCTTTGCTCCTGAATGCGGTCGATGCCAAAGGAAGATCCTTGGAGAAGTCATCAATGCTTTGAAACAAACTTGGCATGTTTCCTGTTTTGTGTGTGTGGCCTGTGGAAAACCCATTCGTAATAATGTTTTTCACTTGGAGGATGGTGAACCCTATTGTGAGACGGATTATTATGCCCTCTTTGGTACTATATGCCGTGGATGTGAATTTCCCATAGAAGCTGGCGACATGTTTCTGGAGGCTCTGGGCTATACCTGGCATGACACTTGCTTCGTATGCTCAGTATGTTGTGAAAGTTTGGAAGGTCAGACCTTTTTCTCCAAGAAGGACAAGCCTCTTTGCAAGAAACATGCTCATGCTGTGAATTTTTGAAAGTCAACAGTTCAAGAGAAGAGAAGAAATTTGAAAAGAAAGAGGAGAATTAAAATTACCAATTAATTTTTAGATTTAATATTTATATGGAGTTTGAAAAATAATAGTGGCCCTGAAGGGATAAATTCCAGCTTTAAAAACCGAGTCTTTGAAGAAATATTTGGCTACATAACGTAAAGAGACAGTTTGGCATTTATTATTACTTTTTTCCCTGTATTTTCTGCCCATAAAATAACTTTCATAAAAATCAATTTCCTGGTTGACTATTAAATTCATCTTAGAATAAATTAGTAAAGAATTAAATTTTAGAAAATCTCAAACCTCTATGCTGAAATAATTATGGTTTCTTTCCTTGTTATGAGTAAATCTGTAAAAGGCAATGAAAGTGCCTTATACTTTTATCATTAAATGAAACATTGTATTTTTTTTAAGAATAATGTTTATCTTTAAAACAGTAAATAGGAGTTTAAACAGAGCATTTTATCAGTAGGTGTCAATTTTTACAAACTGTGTACATTTTTTTTGTCTTACAATCGATCATTCCAGTAGGAAAGATCAATGAGATTTTTCATCAAAATGCATCATGCCAATAAGAGATGCTATATTTTTCTTCATCCCTTTCAAAAGCTACCTACCATATGGCTTATAAATCTCAAATTTTTGCCTTTTATTAAAATATGGCCATTCCTATTCATTGTGTGTGTTTTATCGCCTATATTAGTCAAACTCTTTTTACCCCCGCTCCTTCATGCTGAGGTAAAGAGCTAATTGGATAACTTTGGACTGTAACAGTTTTCTCTCTATATAAAGAGAATAAGTAGGAAAGAATGTGGTTGTATCCAAAATATTCTCCTCCCCAATTCAGATCATGAATCGGTTTCAGAGTTGTACTACTGACAAGTGAAGGTTTGAGAACTCTCTTTGCAGAGTATTTTTTTCTTTAATTCTACATTAGAAAAATAAAAG