Transcript asmbl_23260

Sequence
Transcript Sequence for observation asmbl_23260 of TGE0004287:
GGCACACTCTCCACCGCTGAGCCTTCCCTGTGTTTTCTTGATCCTATCAGCTTCCTCTCAGCTGAGATCGCGCCGCGTCAACTTCCGGGCGGGTGCCCGCCAGCACAGCCTCCGCCGCTCCCCTGCTTTGGCCCCTTTGTGTCCCCGCAGTGTCGAGGCGCGGGCCCTGGCACGTCCTTTCTCGAGGCAGGCAGCACGGTAGTGCAGGGAGCTTTTCACTGTGGGCGGGCGCGCTGCCCGCAGGGGGGTCGGAGTGGGGAACGTGCCTGCGCGTGCTGGGATAGTTCATTTAAAATTCCCAAGGGTGGTGGTTTCTACCAATATGAATCTTTTCAACCTGGACCGTTTTCGCTTTGAAAAGAGGAGTAAGATTGAGGAAGCGCCCGAAGCAACCCCTCAACCCTCCCTGCCTGGCCCTTCTTCACCAATTTCTCTTAGTGCTGAAGAGGAGAATGCTGAAGGGGAAGTTAGCAGGGCAGGCACCCCTGATTCAGATATAACTGAAAAAACAGAAGATTCTAGTGTTCCAGAAGCTCCAGTAAATGAAAGAAAAGCGAGTATATCATATTTCAAGAATGAGGGAGGAATACAGTATATTGATTTGTCTTCTGACAGTGAAGATGTTGTTTCCCCAAACTGTTCCAATACAGTTCAAGAGACAAAATTCAACAAAGACACAGTGATTATAGTTTCTGAGCCATCCGAAGATGAAGAGTCCGAAGGCCTTCCTGCCATGGCAGGTAGAAATAATGACGATATTTCAGAATTGGAAGACCTTTCGGAATTAGAAGATCTTAAAGATGCTAAACTTCAGACCTTGAAGGAACTTTTCCCACAAAGAAGTGACAGTGATTTACTTAAGTTGATTGAATCAACCAGCACGATGGATGGGGCAATTGCTGCTGCGTTGCTGATGTTTGGTGATGCAGAAGGTGGCGGACCCAGGAAAAGAAAATTATCTTCTTCTTCAGAGCCATATGAGGAAGATGAATTTAATGATGATCAGTCCATAAAAAAGAAAAGACTAGATCATGGAGAGGAATCAAATGAGTCTGCCGAATCTAGCAATAATTGGGAAAAGCAGGAAAGTATTGTATTGAAATTACAAAAGGAATTTCCCAATTTTGATAAACAGGAACTAAGGGATGTACTCAAGGAACATGAATGGATGTACTCAGAAGCTTTAGAATCTTTAAAGGTATTTGCAGAAGACCAAGATATGCAATATGCTTCACAAAGTGAGTTTCCAAATGGAAAAGAAGTTTCTTCAAGGAGTCAAAATTATCCTAAAAGTGTAACTAAAACAAAATTAAAACAGAAATGTGCCATGAAACCACAAAATGGTTTTAACAAGAAACGTAAAAAAAATGTATTTAATCCTAAGAGAGTCATTGAAGACTCTGAATATGATTCAGGTTCTGATGTCGGTAGTTCGCTAGATGAGGACTATAGTAGTGGCGAGGAAGTGATGGAGGATGGCTATAAAGGTAAAATTCTTCACTTCCTTCAAGACGCTTCAGTTGCTGAACTTACTTTGATTCCTCAGTGTTCTCAGAAAAAGGCTCAGAAGATAACAGAACTCCGGCCCTTTAATAGTTGGGAAGCTCTGTTCACAAAGATGTCCAAAACTAATGGCTTGTCAGAAGATTTGATATGGCACTGTAAAACACTGATCCAAGAAAGGGATGTAGTTATAAGGCTTATGAACAAATGTGAAGACATTTCTAATAAATTGACAAAACAAGTTACCATGCTCACTGGAAATGGAGGTGGATGGAACATAGACCAACCCTCCATTCTGAACCAAAGTTTATCACTCAAGCCCTATCAGAAGGTTGGTTTGAATTGGTTGGCATTGGTACATAAACATGGACTTAATGGCATTTTGGCAGATGAAATGGGCCTAGGAAAAACTATTCAAGCCATTGCATTCCTGGCATACCTGTATCAGGAGAGTAATAAAGGTCCTCATTTGATTGTTGTTCCAGCATCAACTATAGATAACTGGTTAAGGGAAGTTAATTTATGGTGCCCCACTTTAAAGGTGCTCTGTTACTATGGTTCTCAAGAAGAACGTAAACAGATAAGATATAACATTCATAGTAAATATGAAGAATACAATGTAATTGTGACCACGTATAATTGTGCAATCAGCAGTTCTGATGATCGCAGTCTCTTTCGGCGACTAAAACTTAATTACGCAATTTTCGATGAGGGCCATATGCTGAAGAATATGGGCTCCATTCGCTACCAGCACCTTATGACAATTAATGCAAATAACCGTTTGCTGCTCACAGGCACACCTGTACAGAATAATCTGTTAGAACTCATGTCACTGTTGAATTTTGTTATGCCACACATGTTTAGTAGTAGCACCAGTGAAATACGAAGAATGTTTTCTTCTAAGACAAAATCAGCAGATGAGCAAAGTATATATGAAAAGGAGAGAATAGCACACGCAAAACAAATTATAAAACCATTTATTCTCAGAAGAGTAAAAGATGAGGTTCTCAAGCAGCTGCCCCCTAAGAAAGATCAAATTGAGTTGTGTACAATGTCAGAGGAACAGGAACAACTCTATTTGGGTCTTTTCAACAGATTGAAAAAATCTATCAATAACTTGGAAAAAAACACAGAAATGTGCAATGTCATGATGCAATTGAGAAAAATGGCCAATCATCCTTTATTACATCGCCAATATTACACAGCTGAAAAACTCAAGGAAATGTCTCAGCTTATGCTAAAGGAACCTACACATTGTGAAGCTAACCCTGACCTGATCTTTGAAGATATGGAGGTTATGACAGACTTTGAATTACATGTACTTTGTAAACAATATCGACACATTAATAACTTCCAGTTAGACATGGACTTGATTTTAGATTCTGGAAAATTCCGAGCTTTAGGACGCATCTTGTCTGAATTGAAACAGAAGGGTGATAGAGTTGTGTTATTTAGCCAGTTTACCATGATGCTGGATATTTTAGAGGTTCTCTTAAAACATCATCAGCATAGGTACCTCAGATTAGATGGAAAAACTCAGATTTCTGAAAGGATTCATCTAATTGATGAGTTTAATACCGATATGGATATCTTTGTGTTCCTGCTGTCAACGAAAGCTGGTGGCTTAGGAATAAACCTGACTTCAGCGAATGTTGTTATACTTCACGATATTGACTGTAATCCTTACAATGACAAACAAGCAGAGGATAGATGCCATAGAGTAGGCCAGACTAAAGAAGTATTAGTTATAAAATTAATAAGCCAAGGGACAATTGAAGAATCCATGCTAAAAATTAACCAACAGAAATTGAAACTAGAACAAGATATGACCACAGTAGATGAAGGTGATGAAGGAAGCATGCCCGCAGATATAGCCACGTTACTAAAAACGTCAATGGGCCTGTGAAGTAAGACTTGTGAATTCCTGA