Transcript asmbl_23259

Sequence
Transcript Sequence for observation asmbl_23259 of TGE0004287:
GGAGGTCCCGGCCCGGCTCCCGTCGCCCCACTCCAGGAATTATTTTTTCCTTTTCAACCTTTGTTGTAACGCACTGAGACTGCAAGACTATAGTTCATTTAAAATTCCCAAGGGTGGTGGTTTCTACCAATATGAATCTTTTCAACCTGGACCGTTTTCGCTTTGAAAAGAGGAGTAAGATTGAGGAAGCGCCCGAAGCAACCCCTCAACCCTCCCTGCCTGGCCCTTCTTCACCAATTTCTCTTAGTGCTGAAGAGGAGAATGCTGAAGGGGAAGTTAGCAGGGCAGGCACCCCTGATTCAGATATAACTGAAAAAACAGAAGATTCTAGTGTTCCAGAAGCTCCAGTAAATGAAAGAAAAGCGAGTATATCATATTTCAAGAATGAGGGAGGAATACAGTATATTGATTTGTCTTCTGACAGTGAAGATGTTGTTTCCCCAAACTGTTCCAATACAGTTCAAGAGACAAAATTCAACAAAGACACAGTGATTATAGTTTCTGAGCCATCCGAAGATGAAGAGTCCGAAGGCCTTCCTGCCATGGCAGGTAGAAATAATGACGATATTTCAGAATTGGAAGACCTTTCGGAATTAGAAGATCTTAAAGATGCTAAACTTCAGACCTTGAAGGAACTTTTCCCACAAAGAAGTGACAGTGATTTACTTAAGTTGATTGAATCAACCAGCACGATGGATGGGGCAATTGCTGCTGCGTTGCTGATGTTTGGTGATGCAGAAGGTGGCGGACCCAGGAAAAGAAAATTATCTTCTTCTTCAGAGCCATATGAGGAAGATGAATTTAATGATGATCAGTCCATAAAAAAGAAAAGACTAGATCATGGAGAGGAATCAAATGAGTCTGCCGAATCTAGCAATAATTGGGAAAAGCAGGAAAGTATTGTATTGAAATTACAAAAGGAATTTCCCAATTTTGATAAACAGGAACTAAGGGATGTACTCAAGGAACATGAATGGATGTACTCAGAAGCTTTAGAATCTTTAAAGGTATTTGCAGAAGACCAAGATATGCAATATGCTTCACAAAGTGAGTTTCCAAATGGAAAAGAAGTTTCTTCAAGGAGTCAAAATTATCCTAAAAGTGTAACTAAAACAAAATTAAAACAGAAATGTGCCATGAAACCACAAAATGGTTTTAACAAGAAACGTAAAAAAAATGTATTTAATCCTAAGAGAGTCATTGAAGACTCTGAATATGATTCAGGTTCTGATGTCGGTAGTTCGCTAGATGAGGACTATAGTAGTGGCGAGGAAGTGATGGAGGATGGCTATAAAGGTAAAATTCTTCACTTCCTTCAAGACGCTTCAGTTGCTGAACTTACTTTGATTCCTCAGTGTTCTCAGAAAAAGGCTCAGAAGATAACAGAACTCCGGCCCTTTAATAGTTGGGAAGCTCTGTTCACAAAGATGTCCAAAACTAATGGCTTGTCAGAAGATTTGATATGGCACTGTAAAACACTGATCCAAGAAAGGGATGTAGTTATAAGGCTTATGAACAAATGTGAAGACATTTCTAATAAATTGACAAAACAAGTTACCATGCTCACTGGAAATGGAGGTGGATGGAACATAGACCAACCCTCCATTCTGAACCAAAGTTTATCACTCAAGCCCTATCAGAAGGTTGGTTTGAATTGGTTGGCATTGGTACATAAACATGGACTTAATGGCATTTTGGCAGATGAAATGGGCCTAGGAAAAACTATTCAAGCCATTGCATTCCTGGCATACCTGTATCAGGAGAGTAATAAAGGTCCTCATTTGATTGTTGTTCCAGCATCAACTATAGATAACTGGTTAAGGGAAGTTAATTTATGGTGCCCCACTTTAAAGGTGCTCTGTTACTATGGTTCTCAAGAAGAACGTAAACAGATAAGATATAACATTCATAGTAAATATGAAGAATACAATGTAATTGTGACCACGTATAATTGTGCAATCAGCAGTTCTGATGATCGCAGTCTCTTTCGGCGACTAAAACTTAATTACGCAATTTTCGATGAGGGCCATATGCTGAAGAATATGGGCTCCATTCGCTACCAGCACCTTATGACAATTAATGCAAATAACCGTTTGCTGCTCACAGGCACACCTGTACAGAATAATCTGTTAGAACTCATGTCACTGTTGAATTTTGTTATGCCACACATGTTTAGTAGTAGCACCAGTGAAATACGAAGAATGTTTTCTTCTAAGACAAAATCAGCAGATGAGCAAAGTATATATGAAAAGGAGAGAATAGCACACGCAAAACAAATTATAAAACCATTTATTCTCAGAAGAGTAAAAGATGAGGTTCTCAAGCAGCTGCCCCCTAAGAAAGATCAAATTGAGTTGTGTACAATGTCAGAGGAACAGGAACAACTCTATTTGGGTCTTTTCAACAGATTGAAAAAATCTATCAATAACTTGGAAAAAAACACAGAAATGTGCAATGTCATGATGCAATTGAGAAAAATGGCCAATCATCCTTTATTACATCGCCAATATTACACAGCTGAAAAACTCAAGGAAATGTCTCAGCTTATGCTAAAGGAACCTACACATTGTGAAGCTAACCCTGACCTGATCTTTGAAGATATGGAGGTTATGACAGACTTTGAATTACATGTACTTTGTAAACAATATCGACACATTAATAACTTCCAGTTAGACATGGACTTGATTTTAGATTCTGGAAAATTCCGAGCTTTAGGACGCATCTTGTCTGAATTGAAACAGAAGGGTGATAGAGTTGTGTTATTTAGCCAGTTTACCATGATGCTGGATATTTTAGAGGTTCTCTTAAAACATCATCAGCATAGGTACCTCAGATTAGATGGAAAAACTCAGATTTCTGAAAGGATTCATCTAATTGATGAGTTTAATACCGATATGGATATCTTTGTGTTCCTGCTGTCAACGAAAGCTGGTGGCTTAGGAATAAACCTGACTTCAGCGAATGTTGTTATACTTCACGATATTGACTGTAATCCTTACAATGACAAACAAGCAGAGGATAGATGCCATAGAGTAGGCCAGACTAAAGAAGTATTAGTTATAAAATTAATAAGCCAAGGGACAATTGAAGAATCCATGCTAAAAATTAACCAACAGAAATTGAAACTAGAACAAGATATGACCACAGTAGATGAAGGTGATGAAGGAAGCATGCCCGCAGATATAGCCACGTTACTAAAAACGTCAATGGGCCTGTGAAGTAAGACTTGTGAATTCCTGA