Transcript asmbl_22592

Sequence
Transcript Sequence for observation asmbl_22592 of TGE0015160:
CTGCTAGTCTATGGGGTCCTTACAAAGACATTTGGCAAATGGTGGGAAATGCTCTCTGGAGAAGACAACCCGAAGCTGTCCACCTGCTCGACATGATTCTGAAGAAACATAAGCCAGACTTCATCTCACTGTTCAAAAATCCACCAAAAAATGTTCAACAGCATGAGAAGGTTCAGAAGGCTAGTACAGAGGGAGTCGCCATCCAGGGTCAGCAAGGGACCCGACTGCTTCCGGAACAGCTCATTAAAGAGGCCTTTATCCTCAGCGATCTTTTCGATATTGGAGAACTGGCTGCTGTGGAGCTTCTCCTTGCTGGAGAGCACCAACAGCCACATTTTCCTGGCCTCACCAGAGGATTAGTAGCTGTCCTCTTATATTGGGATGGAAAGCGATGCATTGCAAATTCCCTGAAAGCCTTAATACAGTCTAGACGAGGAAAGACATGGACCCTCGAACTCAGTCCAGAGCTGGTTTCCATGACAACACGCTTTACAGATGAGCTGATGCAGCAAGGGTTGACTTATAAAATCCTTACTCTGGTGTCACAGATTGATGTGAACAATGAGTTTGAGAAACTACAGCGTGAGAGAGGTTTGGGCAGCGAAAAACATCGCAAAGAGGTTTCCGATCTCATCAAGGAGTGCAGGCAGTCTCTGGCAGAAAGCCTTTTTGCCTGGGCTTGCCAGTCACCATTAGGCAAAGATGACACTCTACTCCTTATTGGACATTGGAAAGAGTTTTTTTAAGAGTGACAGTTGAGGCTAATGGCTCATTGGATACAGTGAATCTGGCTCTTCTTATGGCACTTCTGTACTGTTTTGACATCAGTTTTCTAGAACAGAGCACAGAGGAACGTGATGACATGATTCATCAACTTCCACTATTGACAGAGAGACAGTATATTGCAACAGTTCACTCTCGCCTTCAAGACTCACAGCCTTGGAAACTGCCTGGACTGCAAGCCACTGTTAGACTTGCCTGGGCACTGGCACTGAGGGGAATATCTCAGCTACCTGATGTGACAGCTCTGGCTGAATTCACAGAAGCAGATGAAGCAATGGCAGAGCTCGCAATTGCTGACAATGTTTTCCTGTTCCTCACTGAATCCGTAGTAGTGTCAGAAAACTTCTATCAGGACGAATTTTATATTCGTAGAATCCATAATCTCATCACGGATTTCCTTGCACTTATGCCAATGAAGGTGAAGCAGTTGAGGAATCGGGCAGATGAAGATGCTCGAATGATTCACATGAGTATGCAGATGGGTAATGAACCCCCCATTTCACTTAGAAGGGATCTGGAACACTTAATGCTATTGATTGGTGAGCTATATAAAAAGAACCCTTTTAATTTAGAGCTTGCTCTGGAATATTGGTGTCCCTCAGAGCCTCTTCAGACGACCACTCTACTGGGTTCTTACCTTGGGGTGGCTCACCAGCGACCCCCTCAGCGCCAGGTTGTCTTGTCAAAGTTTGTTAGGCAAATGGGTGACCTGTTGCCTCCAACTATTTATATTCCTTATCTGAAAATGCTCCAGGGGTTGGCCAGCGGGCCCCAGTGTGCCCACTACTGTTTTAGCCTGCTCAAAGTCAACGGTGGCGGTCATGTTGAAAATATTCAGGGAGCAGGGGGCAGTCCTGTTTCCTGGGAACATTTCTTTCACTCCTTAATGCTTTACCATGAACACCTCCGGAAGGATCTTCCGAGTGCAGACAGTGTCCAGTACCGTCACCTTCCTTCGCGTGGCATCACCCAGAAGGAGCAGGATGGACTGATCGCTTTTTTACAGCTCACATCTACCATCATTACGTGGAGTGAAAATGCTCGTCTGGCACTCTGTGAACATCCTCAGTGGACCCCGGTTGTGGTGATTCTGGGACTCCTGCAGTGCAGTATCCCCCCTGTTCTAAAGGCCGAGCTGCTGAAGACACTGGCAGCTTTTGGAAAATCTCCTGAAATTGCTGCTTCCCTCTGGCAGTCATTGGAATACACCCAGATACTGCAGACTGTAAGGGTTCCAAGCCAGAGGCAAGCTATTGGTATTGAGGTCGAACTAAATGAAATAGAATCCCGGTGTGAAGAATACCCGTTGACTCGGGCCTTTTGCCAACTTATTAGTACCCTGGTGGAGAGCTCGTTTCCTTCTAATTTGGGTGCTGGACTGCGGCCCCCTGGCTTTGACCCTTATTTGCAGTTCCTCAGAGATTCTGTGTTTCTCCGATTCCGCACAAGAGCTTACCGGAGAGCAGCTGAAAAGTGGGAAGTTGCTGAAGTTGTTTTGGAAGTGTTTTATAAATTGCTTAGAGATTATGAGCCCCAACTTGAAGATTTTGTAGACCAGTTTGTGGAACTACAAGGAGAAGAAATCATAGCCTATAAGCCACCAGGATTTAGTCTGATGTATCATCTTCTGAATGAGTCACCAATGTTGGAGCTTGCTCTTAGCTTACTGGAAGAAGGCGTTAAGCAGCTGGATACTTATGCCCCTTTCCCTGGGAAGAAGCATTTGGAGAAAGCGGTACAGCACTGCCTTGCCCTTCTCAATCTTACTCTGCAAAAGGAAAACCTCTTTATGGATCTTCTAAGAGAGAGTCAACTGGCTCTGATAGTCTCTCCTTTAGAACAGCTTCTGCAGGGCATCAATCCCAGAACTAAGAAGGCTGATAATGTGGTGAATATTGCCAGATACCTGTATCATGGCAATACTAATCCAGAATTGGCTTTCGAAAGTGCCAAGATCCTCTGCTGTATCTCTTGCAACACCAATATTCAGATAAAATTGGTTGGAGATTTCACACATGACCAGAGTGTAAGTCAGAAGCTGATGGCTGGATTCGTGGAGTGTTTGGATAGTGAAGATACAGAAGAATTTGTACGTTTAGAAGAGGGATCAGAACTTGAAAAGAAATTAGCTGGCATCCGTCATGAAACAAGAATCCACATCTTGAATCTTCTCATCACCTCTTTGGAACGCAATCCACCCAGTCTTGCTCTCTACCTGTTAGGCTTTGAATTAAAGAAACCTGTCAGTACCACAAACCTACAAGATCCAGGAGTGTTAGGCTGCCCTCGAACGTGCCTTCACGCCATCTTAAACATCTTGGAGAAAGGAACGGAAGGGAGGACAGGCCCGGTGGCAGTGAGAGAATCGCCTCAACTCGCTGAGCTGTGTTACCAGGTGATATATCAGTTATGTGCATGCTCCGATACATCTGGCCCTACTATGAGGTACTTGAGAACCAGCCAGGATTTCTTATTTTCTCAATTGCAACATTTACCTTTTTCTAATAAAGAATATGAAATATCTATGTTGAACCAAATGTCATGGCTGATGAAGACTGCTTCGATAGAACTAAGGGTAACCTCTCTGAATCGTCAGCGGTCACATACCCAGCGGCTCCTGCACCTCTTGTTGGATGACATGCCAGTGAAACCATACTCAGATGGTGAAGGAGGAGTAGAAGATGAAAATAGGTCTGTCTCTGGATTCCTTCACTTTGACACTGCCACAAAAGTGCGTCGAAAAATTCTGAGTATTCTTGACTCAATTGACTTTAGTCAGGAGATACCCGAGCCTTTGCAGTTGGATTTCTTTGATCGGACTCAGATTGAACAAGTTATTGCTAACTGTGAACATAAGAATTTACGGGGACAGACAGTCTGCAATGTCAAGCTTCTTCATAGGGTTCTTGTAGCCGAAGTTAATGCCCTTCAGGGTATGGCAGCCATAGGACAGAGACCTCTACTGATGGAGGAAATCAGCACTATACTTCAGTATGTGGTAGGAAGAAACAAATTGTTGCAGTGTCTTCATGCAAAACGGCACGCGCTGGAGTCATGGCGGCAGCTGGTAGAAATTATACTGACAGCTTGTCCCCAGGACCTCATTCAGGCAGAGGACCGACAACTGATTATTCGTGATATTTTACAAGATGTGCATGATAAGATCCTGGATGATGAAGCAGCACACGAGTTAATGCCGGTGGTAGCAGGTGCTGTGTTCACCCTGACTGCTCACTTGAGCCAGGCCGTTCGCACAGAACAGAAGCATCCATTAGCCTTGAGGCCTGGAGAGGCCCATTACGCTTTTACGCTCGATGGTTGTTTCACCTCACCTCCTCCAGCAGAGAACCCAGTGGTGGGTTTTGCTTCTATTGGAGATTCTTCACTTCACATCATATTGAAGAAACTGTTAGACTTCATTTTGAAGACAGGTGGCGGATTCCAGCGAGTGAGGACACACCTGTATGGCTCTCTGCTTTATTATTTACAGATCGCCCAGAGACCAGATGAACCGGACACCTTAGAAGCAGCCAAGAAAACCATGTGGGAAAGATTGACAGCTCCTGAAGACGTGTTTAGTAAATTGCAGCGAGAAAACGTAGCCATCATCGAGAGCTATGGTGCCGCCCTCATGGAGGTGGTTTGTCGGGACGCTTGTGACGGCCATGAGATCGGAAGGATGCTGGCGCTGGCTCTGCTTGATCGGATCGTCTCTGTAGACAGGCAGCAGCAGTGGCTTCTGTACCTCTCCAACAGTGGCTATTTGAAGGTGCTTGTGGACAGCTTGGTAGAAGATGACCTTACGTTGCAGAGCTTACTCACCCCACAACCTCCGCTTTTAAAAGCCCTTTATACCTATGAATCCAAAATGGCATTTCTCACGAGAGTAGCTAAGATACAGCAGGGTGCCTTAGAGCTGCTGAGATCTGGGGTGATCGTGAGACTGGCACAATGCCAAGTCTATGACATGCGCCCAGAAGTGGACCCGCAGGGCGTGTTTGGCATGAGAGACCCCCCAGTGTTCATCCCTACTCCGGTGGACCGGTACCGCCAGATTCTCCTTCCGGCTCTCCGCTTGTGCCAGGTCATCCTCACGTCTAGTATGGCCCAACACTTGCAGGCAGCAGGGCAGGTGTTGCAGTTTCTCATTTCGCATTCTGATACCATACAAGCAATCCTGCGCTGCCAGGATGTTAGTGCTGGGTCTTTGCTGGAGTTGGCTCTGCTCACAGGAATTATAAGTAAAGCAGCACTTCCTGGTATATTAAGTGAACTTGATGTGGATGTAAATGAAGGATCTCTAATGGAGCTACAGGGACATATTGGAAGGTTCCAGGTAACTGATTCGTATTTCTTTAAAG