Transcript asmbl_22591

Sequence
Transcript Sequence for observation asmbl_22591 of TGE0015159:
CTGCTAGTCTATGGGGTCCTTACAAAGACATTTGGCAAATGGTGGGAAATGCTCTCTGGAGAAGACAACCCGAAGCTGTCCACCTGCTCGACATGATTCTGAAGAAACATAAGCCAGACTTCATCTCACTGTTCAAAAATCCACCAAAAAATGTTCAACAGCATGAGAAGGTTCAGAAGGCTAGTACAGAGGGAGTCGCCATCCAGGGTCAGCAAGGGACCCGACTGCTTCCGGAACAGCTCATTAAAGAGGCCTTTATCCTCAGCGATCTTTTCGATATTGGAGAACTGGCTGCTGTGGAGCTTCTCCTTGCTGGAGAGCACCAACAGCCACATTTTCCTGGCCTCACCAGAGGATTAGTAGCTGTCCTCTTATATTGGGATGGAAAGCGATGCATTGCAAATTCCCTGAAAGCCTTAATACAGTCTAGACGAGGAAAGACATGGACCCTCGAACTCAGTCCAGAGCTGGTTTCCATGACAACACGCTTTACAGATGAGCTGATGCAGCAAGGGTTGACTTATAAAATCCTTACTCTGGTGTCACAGATTGATGTGAACAATGAGTTTGAGAAACTACAGCGTGAGAGAGGTTTGGGCAGCGAAAAACATCGCAAAGAGGTTTCCGATCTCATCAAGGAGTGCAGGCAGTCTCTGGCAGAAAGCCTTTTTGCCTGGGCTTGCCAGTCACCATTAGGCAAAGATGACACTCTACTCCTTATTGGACATTGGAAAGAGTTTTTTTAAGAGTGACAGTTGAGGCTAATGGCTCATTGGATACAGTGAATCTGGCTCTTCTTATGGCACTTCTGTACTGTTTTGACATCAGTTTTCTAGAACAGAGCACAGAGGAACGTGATGACATGATTCATCAACTTCCACTATTGACAGAGAGACAGTATATTGCAACAGTTCACTCTCGCCTTCAAGACTCACAGCCTTGGAAACTGCCTGGACTGCAAGCCACTGTTAGACTTGCCTGGGCACTGGCACTGAGGGGAATATCTCAGCTACCTGATGTGACAGCTCTGGCTGAATTCACAGAAGCAGATGAAGCAATGGCAGAGCTCGCAATTGCTGACAATGTTTTCCTGTTCCTCACTGAATCCGTAGTAGTGTCAGAAAACTTCTATCAGGACGAATTTTATATTCGTAGAATCCATAATCTCATCACGGATTTCCTTGCACTTATGCCAATGAAGGTGAAGCAGTTGAGGAATCGGGCAGATGAAGATGCTCGAATGATTCACATGAGTATGCAGATGGGTAATGAACCCCCCATTTCACTTAGAAGGGATCTGGAACACTTAATGCTATTGATTGGTGAGCTATATAAAAAGAACCCTTTTAATTTAGAGCTTGCTCTGGAATATTGGTGTCCCTCAGAGCCTCTTCAGACGACCACTCTACTGGGTTCTTACCTTGGGGTGGCTCACCAGCGACCCCCTCAGCGCCAGGTTGTCTTGTCAAAGTTTGTTAGGCAAATGGGTGACCTGTTGCCTCCAACTATTTATATTCCTTATCTGAAAATGCTCCAGGGGTTGGCCAGCGGGCCCCAGTGTGCCCACTACTGTTTTAGCCTGCTCAAAGTCAACGGTGGCGGTCATGTTGAAAATATTCAGGGAGCAGGGGGCAGTCCTGTTTCCTGGGAACATTTCTTTCACTCCTTAATGCTTTACCATGAACACCTCCGGAAGGATCTTCCGAGTGCAGACAGTGTCCAGTACCGTCACCTTCCTTCGCGTGGCATCACCCAGAAGGAGCAGGATGGACTGATCGCTTTTTTACAGCTCACATCTACCATCATTACGTGGAGTGAAAATGCTCGTCTGGCACTCTGTGAACATCCTCAGTGGACCCCGGTTGTGGTGATTCTGGGACTCCTGCAGTGCAGTATCCCCCCTGTTCTAAAGGCCGAGCTGCTGAAGACACTGGCAGCTTTTGGAAAATCTCCTGAAATTGCTGCTTCCCTCTGGCAGTCATTGGAATACACCCAGATACTGCAGACTGTAAGGGTTCCAAGCCAGAGGCAAGCTATTGGTATTGAGGTCGAACTAAATGAAATAGAATCCCGGTGTGAAGAATACCCGTTGACTCGGGCCTTTTGCCAACTTATTAGTACCCTGGTGGAGAGCTCGTTTCCTTCTAATTTGGGTGCTGGACTGCGGCCCCCTGGCTTTGACCCTTATTTGCAGTTCCTCAGAGATTCTGTGTTTCTCCGATTCCGCACAAGAGCTTACCGGAGAGCAGCTGAAAAGTGGGAAGTTGCTGAAGTTGTTTTGGAAGTGTTTTATAAATTGCTTAGAGATTATGAGCCCCAACTTGAAGATTTTGTAGACCAGTTTGTGGAACTACAAGGAGAAGAAATCATAGCCTATAAGCCACCAGGATTTAGTCTGATGTATCATCTTCTGAATGAGTCACCAATGTTGGAGCTTGCTCTTAGCTTACTGGAAGAAGGCGTTAAGCAGCTGGATACTTATGCCCCTTTCCCTGGGAAGAAGCATTTGGAGAAAGCGGTACAGCACTGCCTTGCCCTTCTCAATCTTACTCTGCAAAAGGAAAACCTCTTTATGGATCTTCTAAGAGAGAGTCAACTGGCTCTGATAGTCTCTCCTTTAGAACAGCTTCTGCAGGGCATCAATCCCAGAACTAAGAAGGCTGATAATGTGGTGAATATTGCCAGATACCTGTATCATGGCAATACTAATCCAGAATTGGCTTTCGAAAGTGCCAAGATCCTCTGCTGTATCTCTTGCAACACCAATATTCAGATAAAATTGGTTGGAGATTTCACACATGACCAGAGTGTAAGTCAGAAGCTGATGGCTGGATTCGTGGAGTGTTTGGATAGTGAAGATACAGAAGAATTTGTACGTTTAGAAGAGGGATCAGAACTTGAAAAGAAATTAGCTGGCATCCGTCATGAAACAAGAATCCACATCTTGAATCTTCTCATCACCTCTTTGGAACGCAATCCACCCAGTCTTGCTCTCTACCTGTTAGGCTTTGAATTAAAGAAACCTGTCAGTACCACAAACCTACAAGATCCAGGAGTGTTAGGCTGCCCTCGAACGTGCCTTCACGCCATCTTAAACATCTTGGAGAAAGGAACGGAAGGGAGGACAGGCCCGGTGGCAGTGAGAGAATCGCCTCAACTCGCTGAGCTGTGTTACCAGGTGATATATCAGTTATGTGCATGCTCCGATACATCTGGCCCTACTATGAGGTACTTGAGAACCAGCCAGGATTTCTTATTTTCTCAATTGCAACATTTACCTTTTTCTAATAAAGAATATGAAATATCTATGTTGAACCAAATGTCATGGCTGATGAAGACTGCTTCGATAGAACTAAGGGTAACCTCTCTGAATCGTCAGCGGTCACATACCCAGCGGCTCCTGCACCTCTTGTTGGATGACATGCCAGTGAAACCATACTCAGATGGTGAAGGAGGAGTAGAAGATGAAAATAGGTCTGTCTCTGGATTCCTTCACTTTGACACTGCCACAAAAGTGCGTCGAAAAATTCTGAGTATTCTTGACTCAATTGACTTTAGTCAGGAGATACCCGAGCCTTTGCAGTTGGATTTCTTTGATCGGACTCAGATTGAACAAGTTATTGCTAACTGTGAACATAAGAATTTACGGGGACAGACAGTCTGCAATGTCAAGCTTCTTCATAGGGTTCTTGTAGCCGAAGTTAATGCCCTTCAGGGTATGGCAGCCATAGGACAGAGACCTCTACTGATGGAGGAAATCAGCACTATACTTCAGTATGTGGTAGGAAGAAACAAATTGTTGCAGTGTCTTCATGCAAAACGGCACGCGCTGGAGTCATGGCGGCAGCTGGTAGAAATTATACTGACAGCTTGTCCCCAGGACCTCATTCAGGCAGAGGACCGACAACTGATTATTCGTGATATTTTACAAGATGTGCATGATAAGATCCTGGATGATGAAGCAGCACACGAGTTAATGCCGGTGGTAGCAGGTGCTGTGTTCACCCTGACTGCTCACTTGAGCCAGGCCGTTCGCACAGAACAGAAGCATCCATTAGCCTTGAGGCCTGGAGAGGCCCATTACGCTTTTACGCTCGATGGTTGTTTCACCTCACCTCCTCCAGCAGAGAACCCAGTGGTGGGTTTTGCTTCTATTGGAGATTCTTCACTTCACATCATATTGAAGAAACTGTTAGACTTCATTTTGAAGACAGGTGGCGGATTCCAGCGAGTGAGGACACACCTGTATGGCTCTCTGCTTTATTATTTACAGATCGCCCAGAGACCAGATGAACCGGACACCTTAGAAGCAGCCAAGAAAACCATGTGGGAAAGATTGACAGCTCCTGAAGACGTGTTTAGTAAATTGCAGCGAGAAAACGTAGCCATCATCGAGAGCTATGGTGCCGCCCTCATGGAGGTGGTTTGTCGGGACGCTTGTGACGGCCATGAGATCGGAAGGATGCTGGCGCTGGCTCTGCTTGATCGGATCGTCTCTGTAGACAGGCAGCAGCAGTGGCTTCTGTACCTCTCCAACAGTGGCTATTTGAAGGTGCTTGTGGACAGCTTGGTAGAAGATGACCTTACGTTGCAGAGCTTACTCACCCCACAACCTCCGCTTTTAAAAGCCCTTTATACCTATGAATCCAAAATGGCATTTCTCACGAGAGTAGCTAAGATACAGCAGGGTGCCTTAGAGCTGCTGAGATCTGGGGTGATCGTGAGACTGGCACAATGCCAAGTCTATGACATGCGCCCAGAAGTGGACCCGCAGGGCGTGTTTGGCATGAGAGACCCCCCAGTGTTCATCCCTACTCCGGTGGACCGGTACCGCCAGATTCTCCTTCCGGCTCTCCGCTTGTGCCAGGTCATCCTCACGTCTAGTATGGCCCAACACTTGCAGGCAGCAGGGCAGGTGTTGCAGTTTCTCATTTCGCATTCTGATACCATACAAGCAATCCTGCGCTGCCAGGATGTTAGTGCTGGGTCTTTGCTGGAGTTGGCTCTGCTCACAGGAATTATAAGTAAAGCAGCACTTCCTGGTATATTAAGTGAACTTGATGTGGATGTAAATGAAGGATCTCTAATGGAGCTACAGGGACATATTGGAAGGTTCCAGCGCCAGTGCTTAGGACTACTAAGTCGCTTTGGTGGCTCGGACAGACTCCGTCAGTTTAAATTTCAAGATGATAATGTGGAAGGAGATAGAGTGAGCAAGAAAGACGAGATTGAACTGGCTATGCAACAGATTTGTGCCAATGTCATGGAATATTGCCAGTCGCTCATGTTACAGAGTTCCCCTACCTTTCTGCATGCCGTGTGTCTCTTCACCCCAAGCCTGTCAGAAACCGTTAACAGAGATGGGCCCCGGCAAGATACCCAAGCTCCAGTAGTTCCGTATTGGCGCCTGCCTGGTTTGGGCATTATTGTCTACCTGCTGAAACAGAGCGCTAGTGATTTCTTCAGCTATTATGACAGTCACCGACGGAGTGTCAACAAGCTACAGAATGTAGAGCAGCTTCCACCAGATGAGATAAAAGAGTTATGTCAGTCTGTGATGCCTGCTGGTGTTGATAAAATCTCCACCACCCAGAAATATGTTCTAGCAAGACGGCGTTTGGTGAAGCTGATCAACAATCGAGCCAAACTGCTTTCCCTTTGTTCTTTCATCATAGAGACCTGCCTCTTTATCCTCTGGCGCCATCTGGAGTACTACCTGTTACATTGCACGCCCACAGATTCGCAAGATTCCTTGTTCGCCTCCAGGACCTTGTTTAAAAGCAGAAGGCTACAAGATTCCTTAGCTTCAGAAGCCAATCTAGATTTTAGAAGTGGACTGACTATAGTGAGCCAACATGACATAGACCAGCTCCAGGCCGACGCTATCAACGCCTTCGGAGAATCACTGCAAAAGAAACTTCTGGACATTGAAGGATTATATTCAAAAGTTCGATCTCGCTATAGTTTCATACAAGCTCTTGTCAGACGTATCCGAGGCTTACTGAGGATATCACGGAACTGAGCTCTTCTAGGGAAGAGATGAATTGGAAAACTGTCTCCTTTTTATAGATTAGTTTGTCTTTAAATTATGACCAAAAAATATTTTGCTATTTCTTTCTTTATATATGGACATCTTTTCTGTAAACTTCTTTGCCTGGTTTCATCCTCATTAGTAAAAAAAATAAACACTTTTTT