Transcript asmbl_22468

Sequence
Transcript Sequence for observation asmbl_22468 of TGE0015139:
GGTAGTGGCTCCAATCCTTTTCGGCATCTGGAGAAGAGCGCTGTTTTACAGGAGGCTCGTCTGTTCAATGAAACACCCATCAATCCAAGAAGATGTTTGCATATTCTTACAAAGATTCTTTACTTACTGAACCAGGGTGAACACTTTGGAACTATGGAAGCCACAGAAGCCTTCTTTGCAATGACTCGATTGTTTCAATCTAATGATCAAACATTGAGAAGAATGTGCTACCTTACCATCAAAGAAATGGCTAACATCTCTGAAGATGTGATAATTGTCACAAGCAGTCTGACCAAGGACATGACAGGAAAGGAAGATGTGTACCGAGGCCCGGCCATCAGGGCTCTCTGCAGAATCACCGATGGAACAATGTTGCAGGCCATTGAACGATACATGAAGCAGGCCATTGTGGATAGAGTCTCCAGTGTATCCAGCTCAGCACTGGTATCTGCCTTACACATGATGAAGATAAGCTATGATGTGGTTAAGCGCTGGGTCAATGAAGCCCAAGAAGCTGCTTCAAGTGATAATATTATGGTCCAGTACCATGCATTGGGAGTCTTGTATCACCTTAAAAAGAATGATCGCCTTGCTGTTTCGAAGATGTTGAATAAATTTACTAAATGTGGTCTCAAATCACAATTTGCTTACTGCATGCTGATCCGAATTGCCAGTCGCTTACTAAAAGAAAATGAAGAGGGTCACGAAAGTCCACTCTTTGATTTCATTGAGAGCTGCTTGCGAAATAAACATGAAATGGTTATTTATGAAGCTGCTTCAGCTATCATCCATCTACCTAACTGTACTGCAAGGGAGTTGGCACCTGCTGTTTCAGTTCTTCAGTTGTTCTGTAGCTCTCCTAAGCCAGCTTTGAGATATGCAGCTGTGAGGACCTTGAACAAGGTGGCGATGAAGCACCCCTCTGCTGTTACTGCCTGCAATCTGGATTTAGAAAACTTGATCACAGACTCAAACAGAAGCATCGCCACCCTTGCCATTACTACACTCCTCAAAACAGGAAGTGAGAGCAGTGTGGACAGGCTCATGAAGCAGATATCTTCTTTTGTGTCCGAAATCTCAGATGAGTTCAAGGTGGTGGTTGTGCAGGCAATTAGTGCTCTCTGTCAGAAATATCCTCGAAAGCACAGCGTCATGATGACTTTCCTCTCCAACATGCTCCGAGACGATGGAGGCTTCGAATACAAGCGGGCCATCGTAGACTGCATAATCAGCATTGTGGAAGAGAACCCAGAGAGCAAAGAAACGGGCCTAGCCCACCTTTGTGAATTCATCGAAGACTGTGAACACACTGTTCTGGCTACTAAGATTCTACACTTGTTGGGCAAAGAGGGCCCCAGAACGCCTGTCCCCTCCAAATATATCCGCTTTATTTTTAATAGGGTCGTACTGGAGAATGAGGCTGTCCGAGCTGCTGCTGTGAGTGCTTTGGCTAAATTTGGGGCTCAGAATGAGAATCTTCTCCCAAGCATCCTTGTACTCCTACAAAGGTGTATGATGGATACTGATGATGAGGTACGGGACAGAGCTACCTTCTATCTGAATGTGCTGCAGCAAAGGCAGATGGCACTGAATGCTACATATATCTTCAATGGTTTGACAGTTTCTGTTCCAGGGATGGAAAAAGCCTTATACCAGTACACATTGGAGCCTTCAGAAAAACCATTTGACATGAAGTCTATTCCTCTCGCTATGGCTCCTGTCTTTGAACAGAAAGCAGAAATCACACTTGTGGCTACTAAGCCAGAGAAGTTGGCTCCTTCCAGGCAAGACATTTTCCAAGAACAATTGGCTGCTATTCCTGAGTTTATGAATCTAGGACCCTTGTTCAAGTCTTCTGAGCCTGTTCAACTTACAGAAGCAGAAACAGAATATTTTGTTCGTTGTATTAAGCACATGTTTACCAACCACATTGTGTTCCAGTTTGACTGTACCAATACTCTCAATGACCAGCTACTGGAGAAAGTGACAGTGCAGGTGGAACCATCAGATTCCTTTGAAGTGCTGTGTTACATTCCCGCCCTCAGCCTCACATATAATCAACCAGGAATATGTTACACTCTTGTCCGTTTGCCCGATGATGACTCTTCAGCAGTTGCAGGCACCTTCAGCTGCACCATGAAGTTTACTGTCCGGGACTGTGACCCTGACACTGGGGTCCCAGCCGAGGAGGGGTATGATGATGAGTACGTGCTGGAAGATCTTGAAGTGACTCTGTCTGACCACATTCAGAAGGTCCTGAAGCCTAGCTTTGCTGCTGCCTGGGAAGAGGTGGGAGATACCTTTGAGAAAGAGGAGACCTTTGCCCTCAGTTCTACCAAAACTCTTGAAGAAGCTGTCAGCAACATCATCACATTTCTGGGCATGCAGCCATGTGAGAGGTCGGATAAAGTACCTGAGAACAAGAATTCTCATTCCCTCTATCTGGCAGGTGTGTATAGAGGTGGCTATGATTTATTGGTGAGGTCAAGGCTGGCCTTAGCAGATGGCGTGACCATGCAGGTGACTGTCAGAAGCAAAGAGGGAACACCTGTAGATGTTATCTTGGCTTCTGTTGGATAAGTTTTTTGGGGGGATGGGGCAAGATGAAGTTGATGTACACTTCACTGCAGTGGGCTTTTAGGGCTAGTGGCATGAATTTCCCAGAATCATACTTTGAAAAATTAATGACTTTGCAGAAGCAAATTAAATGTTTGGCCCTGAGCCAGCAGATCAAGCAAATATCTGTCCTTGTGCATGTCTTTTTATTACACTTGGTCAACTTTGGTATGATAGTACAGCTTCGGGTGATCTTGAAAAGCAAATACTATCCTGTACCCCAGCTGCTTAACTTCATTATATTGTTTAATTTAACGTGTGTCTGAAAGCTCCTGGCAATGTTGAAAAGCTTTTATCCCAGAGGGGTGGTGGGGGAGGGGAAGGCAGAGTCC