Transcript asmbl_22467

Sequence
Transcript Sequence for observation asmbl_22467 of TGE0004232:
GACACTGTAGCCTCAGTCGAGAATCACTCAGATTCACTATCCACTGGTGAACAGGCGGATCCAGCCATAGCCAAACCAAGCATCGTAACAACCAGTGATACGGTCAGTGCAAACACAAAGATGGCACCCAGCGACTCGGAAAAATCGGGGATACCAGCCTCAGACAAGAATATTGCCATTGCTACTGGCTCAAAGACGACTCAAGATCCAGCTCAGAAGTCTATTACACCAACTACTGTCCTGATGAAGACCGAAACCAAAAGCAGCCAGGATGGACTTAAAACTGCACCTGGAACGAAAGTCCAAAGTAGTCCCAGTGTTACTGCGAGCATGACCACGCAGGGAGGTCGCACGGACCTCCAATCTACACAACATCTGAGTAGCTCCACAGACAACAGTCCTGCCCTTTCTTCCTTGACCACCCCAGCGAGCACACAACAGCTGACTCCAGGCTCTCCCAAGGGACCAGACCAAATGACGACAGCTTCAAGTAGTTCAGGCACAACGGCAGGTTACACCTTCACCCCTTCACATCCGAGGACGGCTACCACACTGAGATCATCGATTACCTCGCAAGATCTGCCGACCCCCAGCAAGATGCCAGCCATCACTGGGAACCATTCCTCCACCCCGGGGACCCCTTCCTCCATCCCTGGGATAGCGACTTCTTTGTCCAACACTCTGCAGCCTACGTCTTCATCGGGACCTGTGGCCACATCTTCTGGCGGAACCACAAGCTTCCGTACTCAGTTGGCTCCAACTGCCCCCCAAGACTCCAACATCTCTACTCCCCCCTCGGTTTTCGAGGATGACAGGATAACCTGCACGAAGACCGACCGAAGTCTGAACGAGTCGATGCTCATCTTGAACCTCACGAAAACCGTCCACTGCGCGGGGAGCCCTCTGGATGACAAACTGGTCACACTTCTGTGCCGAGCGGCTAAATCTGCCTTGAACCCAACTCAAGACCAGTGCCACATACATCTGATAGTCAGTTCAGAAGGCCAGGCAGTGGCAGTCGAAGAGATCACTATTCGAACAAAACTCGTTCTTAAGGACGTATATGAATCGCTGAAAGACAAATGGGATGACCTGAAGGAGATGGGAGTCAATGACATGAAGCTTGAGGGTCAAGGACCACCAGATGAGACTGAGGACCGGTTCAGCAAAAAATATTGTCTGCATGGCATCCTTTCTGCTCCTCGTGGCGGCCCTCTATGGCTGCTGCCACCAGCGCCTCTCCCAGAGGAAGGACCAGCAACGACTAACGGAGGAGCTGCAGACCGTGGAGAATGGTTACCATGACAACCCAACACTGGAAGTGATGGAGACCTCATCAGAGATGCAGGAGAAAAAGGTGGTCAACCTTAACGGGGAGCTGGGAGACAGCTGGATCGTCCCCCTGGACAACCTGACCAAGGATGACCTAGATGAGGAGGAAGACACACACCTCTAATCCGGTCTGCTGGCGGCCTCCGACGGTGCCACAGAGCTCCAGACCGGACCACCTCAAGTGCCATTGGGACAGGGGAGGAAAGTCCTTCCCATTTGAGGGAAAGACTGGGGAGGGAGCAGACTTGGAGGGTTCCCTCCTCCTAATCCCGCAAAGGGCCTTAATTTTTCTCTTTCAAACTGAACAAATCATATCCTGTCTAGATTCCTCTTGTAAAATAACCTACTAGTGCCTGAGCTCAGTGCTGCTGGAAGATGAGAGAGAGGAAGGGAAACCAAGAGTGAGCCATACTGGGGACGTAGAGATCAGCTAGTCGAATCCCTTCATTTCACAGATGAGATGACTGAAGCCCGAAGAGGGTAAAGTCAAGGGTGACACAGCCACTTGGTGACAGAGTCAGGATGAAAACAGATTCCTTCCTGCAGGCCAGTGCTCGTTCCACCCTGCCACACTGCTGCGATCCCTCGTGCCCTCCCTCCAGAGCTGCCCCGGGCTGGGGGTGGAGCTGCCAGATGATGGATGGGACAGAAGGGAGAGCAGCGGGGCCCGATCCTGCCTCAGCGGGATCTGGTTCCTTGAAAGCATAGGTCCCAGTTCTGTCTCCTACCCCAGCCTCGTCTGCCATTGTTCTCGTCCCCTTTGTTCTTCCCCTTCCATTCACTCGATTTTTATTCCCATTCTGCCCCAGGATCTTGAGACTAACACAGGTCATTCATGACCTTGAACCCCTTGTCTGGATTCTGGTTTCCTGCCATTTGCTTAGTGAGACTGGGACTTGGACCACACGAGACTCCCAGCGTGAACGAGGTCTGCTTAGGGGTCCGTCTACAGGTGGAGAGCTGGGGAAGCCCTTCCTCCCCGGGTGTGTCCTGGCCCATCACCCAAGGGACTCCCTGAAGAGGCTTCCCAAGTGTTCCATTGGCCTCTCTTCCCCACCAGGGGCTAAATTCCACAGCTAATGAAGGCAAAGGGTTCCTATACTGTTGTTCACTGCTCAGCCAACGGGGGTGAAAATCCCAGCTAGGAAACCCCAAGATTAGCGCGAATGGGCGGCATTCGGACAGACTTTCCCAGGGCCCCAGTCAGCAGAGAGGGCGTCTTGACAGACAATCGAAGGAAGGCCGGGGAGGCTAGGCTCTTCTATTTCATAGGAAACTCAGGGACTTTTCAAGTTGCTGAGAGTTTTGTTATGTTTTCTAACCCAGCCCTCTACTGCCTAAGGCCAAAGCTCAAATTGTAGAGACTTTCAGTGAGCTAAACTCACTGATTAGAGTCTCCTGTGCCATAGGGCAAGAGAGGCCTAGAACATGAGGTGCATTTTAAGGTGCATAACGGGCAGCCCGGGGGCATGGCCGTCTGTCTGTTCTCGGTAACCCCTCACTGTCCTGGCATGGAGCCATGTCCTCTTCTCTGTAGTCCTAGTGGGGCTGCCCTGTTGTCCTGCAGTTTCTGGTAGCATCTCAGGGAAATAAAATACTATCTGTTCCTCAGTAGAGGAGATCTGAGGGGCTCAGCAGTTAGCCACCATGTAGGAAGACTAGGCGTGGTGAGGTTTAATCTGATTTTCTGACGAGAGAATCCTGTGTGGGATTTTGAACTTTGCCCATGGTCACTATTGTTCCTGGGCGTAAGATCCCTGGAATTAACTAGGAAGATGGGCAGCACTGCTTAGGAGAGTGAAAACTGTCATTTCGGGCCAAGAGTCAGAACCCCAGAATGCAGAGGGATGGTTCTGATGACATAGGCTCTCAGATTTGGGATAGATTCTTTTATTAAAAGGGGAGGAGTTTAAGGGGAAGATCTGTGTCCCTCCGTGGCTGCCTGATTCCTTCTTCATAGCTTCTCGCCCGTTGGCTTTGGGGTTCAAGTAGGGGCCCCAGTGAATTTCTCAAGAGTTAGAGAGATACAAAGCTAACAAGGATCCAAAAGCATTCGCCCTGGTTCTCTAGCATGTGGAGGTTGGCAGGATGGAGAACAGTGCCAGTTTGGGGGAAAAGGAAGGATATCTTGTCATGTTGGGAAAAGATCTGGTCACTTCCTTCCTGTCCCGTATTTGGTTCTTTCTATCATGGTGTCTGTGGGAAAGGCCAGGCCGGATTACGGCTCCTATGCTGATTCTGCGTAACATTTCACCAGCCAGGCCTTGAGACCGAGGTAGCAAATATGCCTCTGCAAACTGATCAAAGGTCGCAACCTGTAGGCCTCTTGGGGAGATAGACAATGCCTGGAATGACTGTGGCTCTAAGGAGACCTCTGAGAAGCACTGGGCTGGTTCAGAGGTTCCTTCTTGAGGTCCATCCACATTGTGTTACTCTAGCTTTTTAGGGCAACTTCAGAATCCAATACCTTGCCTCGGCTTGTTCTTGCCACTAGACATCTATGTCAAAGGCCACAGAGCCATGCATCTGCAAAGGACATCTTCTTCCCATCTTTCTACTGGTTTCTAAATGCTGTCAGGTAATTCAGATTCTGGGGCTGAGAAGAGAGAAGAGGAATACCGGCCACTCAGCATGACTTTGAACAAGTTATACCAAAGAGATGATAAACTCTTTACTTCAGTGACACACTGGTTTTCCTAAGCTGCACAAAAGGCTAGAAACCATGCCTCTGATGACTGGACAAAATCCAGTGGGAAACATGCTGTCATAAGCGGGGGGAGAAGCAGCAATGCTTACGAAGGAGGCACAGAAATATGCTTTGCATCGTAAGACAGGATACGGGTTTAATCTAGACACAAGGTTCTTTTTCCCCCCTTTGGTAAGGAAAGTTGGCAGAAAGTTCATTTAAACCACTTCCAAGATTTATCCTTTTTGACAATATGCTGGAGAAACTTTGAAAAATAAGTTCGAGCTGATACATATATACGTATTTTTTGATAATGTAAATAAAAGTCACATATTAATCCACCCTGTACTGCTTTAAGTGAATATACTTTGGAAAAACATTTGTTAGCTAAGAGAGATGGCTTTAAAAACAAAAACAAAACAGGAATGTAAATGTCTATTTTACTAGAAATGACAAGTTTTTTTATTTTTCTTTAATGAAAAACGAAATTTAAGATAGGCTGATGACAAAGTATTTGTCTTGAGTAATGGGCATTTTTAAGTATGATCCTCATCCTTCCCCGGCAAAGTCCCAGCCTATTATAGTAAGGGTTGGAGTCAGTATACACTCATTGGAAAGTGACATTCTAGTCATAGGGAGAGGGTGTTAGAGACCTAGTCCAATATTTTTCTTTAAAGAGAAAACCTGAAGCCCAGAAAGATAAGTGACTTGGCCAAAATCATGTGGTTAGCGACAGAAACCGGATTAAAACATGTGCTGGAAGACTGTCCAGTGTCGTGTGCCTCAGAACCAAATTAAAGACAGGCACCAGAATGACACAGAGGGCTGAATTCCCTTCTCAAATCCTATCTTGCAGCAAGGCTAGGGAGGGCATGAAGACAAAAACAGAAACCTTACTGGTCTTCCACATTCTGAGTTATTTAGGTCTAAGACTTAAATGAACAATTCTGTTGGGGGAAAAAGAAAGTTTTGAATGAGCTTTTATATGATCTGCTACTAGCAGGACTAAGGATCCAGAGGAACAAGACAGGGGAAGGCAGAGGGACAAGAGTAAAGCAAAGGCATCTCTTTCATCATTGTCACCAGCTGATTCACTGAGGTTTGGTGAAAACCCAACACTGGGTGAAAGAAGGCGATTATCACTTGATGTGGGTCTTTTCTGTTATTCGTGAATTTTAAGCAGTTTGCCCAGGAGACTGGGGTG