Transcript asmbl_22357

Sequence
Transcript Sequence for observation asmbl_22357 of TGE0004223:
GGTCAAGAAAATTTGAAGAAGGATCTTGTGAGGAGGATCAAAATGTTGGAGTATGCTCTTAAACAGGAAAGAGCCAAATACCACAAGTTGAAATATGGGACAGAATTGAATCAGGGAGATATGAAGCCTCCAAGCTATGATTCTGATGAAGGTAATGAAACAGAGGTGCAGCCACAACAAAATAGTCAGTTAATGTGGAAACAAGGTCGACAGCTACTCAGACAGTATCTGCAGGAGGTGGGTTACACAGATACTATTCTAGATGTGAAATCTAAACGAGTGCGAGCTTTGTTGGGCTTTTCAAGTGATGTCACTGACAGAGAAGATGACAAAAATCAAGACTCAGTTATAAATGGCACAGAGGGTGAAGTTAAAGACACAGCAATGATTGGAAAATCCGAGTTAACAGATTCTGCCTCTGTGCTGGATAATTTCAAATTCCTTGAAAGTGCAGCTGCAGATTTCAGTGATGAAGACGAAGACGATGACATTGATGGAAGAGAGAAAAGCATCATTGATACTTCAACGATTGTTAGGAAAAAAGCATTGCACGATAGCAGTGAAGATCGAGATACGAAAGAAGCTCTAAAGGAGTTTGACTTCTTGGGTACATCAGAGGAAGGAGACAATGAATCTAGAAGTGCAGGCGATGGAACAGACTGGGAAAAGGAAGACCAGTGTCTCATGCCTGAAGCTTGGAATGTGGACCAGGGAGTAATTACCAAACTCAAGGAGCAATACAAAAAGGAGAGAAAGGGGAAAAAGGGGGTGAAGAGACCCAATAGGTCAAAACTACAAGATATGCTTGCTAATTTGAGAGACGTTGATGAACTTCCTTCATTGCAGCCATCTGTGGGTTCACCTTCCAGACCAAGCAGCTCTAGGCTTCCTGAGCACGAAATAAATAGAGCAGATGAAGTGGAAGCACTGACATTTCCTCCATCTTCTGGGAAGTCATTCATCATGGGAACAGATGAAGCCCTCGAAAGTGAACTGGGACTTGGAGAGTTGGCAGGCCTTACAGTGGCCAATGAAGCAGATTCACTCACTTACGATATAGCAAACAATAAAGATGCATTGAGGAAGACGTGGAACCCTAAGTTTACACTAAGAAGTCACTTTGATGGCATTCGAGCCCTTGCTTTCCACCCCATTGAGCCTGTTTTGATAACAGCATCAGAGGATCACACATTAAAAATGTGGAATTTGCAGAAAACAGCCCCAGCCAAAAAGAGTACATCTCTCGATGTGGAGCCTATCTATACATTCAGGGCTCATAAAGGTCCAGTGCTCTGTGTGGTAATGAGCAGCAACGGCGAGCAGTGTTACAGTGGTGGCTCTGACGGACTGATCCAGGGCTGGAACACCACCAACCCCAACATCGATCCCTACGACTCCTATGATCCTTCTGTTTTAAGAGGCCCTCTGCTAGGACACACCGATGCAGTCTGGGGTTTGGCTTATAGTGCAGCACATCAGCGTTTGTTGTCCTGTTCAGCAGATGGCACTCTCCGTTTATGGAATGCAACTGAGGTTGCTCCAGCCCTCAGCGTATTTAATGATAATCAAGAATTGGGAATTCCTGCCTCTGTGGATCTAGTAAGCAGCGACCCGAGCCATATGGTAGCATCATTCAGCAAAGGATATACAAGCATCTTTAACATGGAAACACAGCAACGCATTCTCACTTTAGAATCCAATCTAGATGCAACAGCCAGTTCTTCCTGCCAAATAAATAGAGTCATCAGTCATCCCACTCTTCCTATAAGCATCACTGCTCATGAAGACAGGCACATCAAATTCTATGATAACAATACAGGCAAACTGATCCACTCGATGGTAGCCCACCTAGAAGCTGTTACAAGTTTAGCAGTTGATCCTAATGGCCTGTACTTGATGTCTGGCAGTCATGACTGTTCAATACGTTTATGGAACCTAGAAAGTAAGACATGTATCCAGGAGTTCACAGCTCATCGGAAAAAGTTTGAAGAATCAATTCATGATGTAGCTTTCCACCCATCCAAATGCTATATAGCCAGTGCTGGGGCTGATGCACTTGCTAAAGTCTTTGTATGACGGAATGTGTCATCTTCACCTTCTAGCTCTTTATAAATAATCACCTGCACAAAAGAGATACAGAAGACCAGGGCAAGAAACAACCCATTCTGCCCTTTCATTCTGCTGAAGGAGCACAGAGAACATTTGTTAAAGTATAGTTTTGCAATTCGTATACTGTTTTCTAAAACTAAAGTTTGTTCAGGTTGCTGCAAGCTCAGCTGAATCTATGAGCCTGAAAACTGATTCAGATTTCCCCCCAAATATAGGAACTTTTATTTCTGAGGTGGTTCTAATTCGCTAGGCAGGCCTGAGCGAACATAGGTTTAGCTGTCCACTATATGAGCTTATTAAAAAGCTTGATGGCTGAGAATAGTAGAGGAAGAGTGGAAATTTAGACCAAGTTCTCCCCTGAGAAATCTTGGTAAACACATTAGTCAAAACAGTAATCTTCACCATCTCTGCTGTACTAACCCTATGTGCATAATGACCAGCCAGTGTTAAAATTAGTTTTTAATTTCTCTCTACATTCAACTGTTCATGTAAAGCACTTGGCAAAGCATTTTACCTATTAGGGGGAAAGAAAAAGAAATGCAATAATATGTTAAGTATATTATTCATAAATACTAAACAAATATTTAGTTTGTAA