Transcript asmbl_22233

Sequence
Transcript Sequence for observation asmbl_22233 of TGE0001355:
CGGCGGCCCGCCCCTCGGCTCGGTGGTAGGCTGAGACGGGAGGGTCCTCGGCTAAAGCCCAAAGCGGATCAAAGTGGTGGGACTCGCGCCGCGGCCGCGGAGACGTGAAGGCCCTCCGCACGCTCCTCCCGATCCCGGTCGGTGCTCGCCCTCGCTGTGCTCCCAGTCCCCATGGAGAAGACGGAGCTGATCCAGAAGGCGAAGCTGGCCGAGCAGGCCGAGCGCTACGACGACATGGCCACCTGCATGAAGGCCGTGACGGAGCAGGGCGCCGAGCTGTCCAACGAGGAGCGCAACCTGCTCTCGGTGGCCTACAAGAACGTGGTAGGGGGCCGCAGGTCCGCCTGGAGGGTCATCTCGAGCATCGAGCAGAAAACCGACACCTCCGACAAGAAGTTGCAGCTGATTAAGGACTATCGGGAGAAAGTGGAGTCGGAGCTGCGGTCCATCTGCACCACCGTCCTGGAATTGTTGGATAAATATTTAATAGCCAATGCAACTAATCCAGAGAGTAAGGTCTTCTATCTGAAAATGAAGGGAGATTACTTCCGGTACCTTGCAGAAGTTGCATGTGGTGATGATCGAAAACAAACGATAGATAATTCCCAAGGAGCTTACCAAGAGGCTTTTGATATAAGCAAGAAAGAGATGCAGCCCACACACCCAATTCGTCTGGGGCTGGCTCTTAACTTTTCTGTATTTTACTATGAGATCCTTAATAACCCAGAGCTTGCCTGCACACTGGCTAAAACGGCTTTCGATGAGGCTATTGCAGAACTTGATACACTGAATGAAGACTCTTACAAAGACAGCACCCTCATCATGCAGTTGCTTAGAGACAACCTAACATTGTGGACATCAGACAGTGCAGGAGAAGAATGCGATGCGGCAGAAGGGGCAGAAAACTAACTGCACGCAGGATGTCGTCCTTCTTCCCTCCAGAAACCTTTTTACACATCTCTGTTCCTTATTCCATTCGGATTTCCTATAGCGAAGAAACGCATTCATGTGTATGGAATCAACTGTTTATAGTCTTTTCACACTGCAGCTTTGGGAAAACTCCATTCCTTGATTTGTGTTTGTCTTGGCCTTCCCGGTGTGCAGTTACTGCTGTAGAAAAGTATTAATAGCTTCATTTCATATGAACATAAGTAACTTCCAAACACTTACATAGAGGACTAAAAATGTATCTGGTATTTAAGTAATCTGAACCAGTTCTGCAAGTGACTGTGTTTTGTATTACTGTGAAGATATGAAAATGTAGTTAATTACAGTTTAAAGAGTGTTCTACATAACTTCTTAATTTCTACATTCCCTCCCTTACTCTTTTTTTGGGGGTTTCCTTTCAGTAAAAACTTTTCCATGTTCTTAATGTATTCCTTTTTGGTAGGAATTCAGAAGTATTAGATTGAATGGAAAAGCATTTGACATTTCCGGGCTGGGGGTCACAAATTAAAATGCCTCCTGTATCACATACAATGGGGTTCCTGTGTATCTGTGACAACAGGGAGTTTCCTTATTCACTCTTCATTTGCTGCTGTTTCAGTTGACAACTTCCCTTCCCAATAAAAATTCACTTACGCCTCCCGCCTTTGTAGTTCTGGTATTCACTTTACTATGTAATAGAAGTAGCATGTTGCTGCCAGAATACAAGCCTTGCTTTTGGCAAATTAAAGTGCATGTCATTTCTTAATACACTAGAAAGGGGAAATAAATTAAGTACACAAGTCCAAGTCTAAAACTTTAGTACTTTTCCATGCAGATTTGTGCACATGTGAGAGGGTGTCCAGTTTGTCTAGTGATTGTTATTTAGAGAGTTGGACCACTATTGTGTGTTGCTAATCATTGACTGTAGTCCCAAAAAAGCCTTGTGAAAATGTTATGCCCTATGTAACAGCAGAGTAACATAAAATAAAATTACATTTTATAAACCATTTACTATGGCTTTGTAACAATTGCATACTCATATTTTAAGGGACAAGTGAATTTACTACTTTCTGAAGTTTATTGATACTTCCCTTTTATGTAAAATGTAGTGATGCCCATATTTCTGCATTGTAATACACTTGTCTAGGGATGTCTGGAAATGTATAAAATTGGCCTACGTTTCTTAGAGTTAGTGTTTTATTCACAGATCGGTTTTGTGGGCCATCTCTTTCTCAGATGTAAATGATACCTAGTTAAGTGTTATATGGAATAAAGTGGACATTTTAAAACTAGAAAA