Transcript asmbl_21443

Sequence
Transcript Sequence for observation asmbl_21443 of TGE0004161:
GTCGCAGGGCCCAACATCTGTACCACACGCGGTGTGAGCTCCTGCCAGCAGTGCCTGGCCGTGAGTCCCATGTGTGCCTGGTGCTCAGATGAGGCCCTGCCTCTGGGCTCTCCCCGCTGCAACCTGAAGGAGAATCTGCTGACGGATAACTGTGCCCTGGAGTCCATCGAGTTCCCCATCAGTGAGGCCAGCATCCTGGAGGCCAGACCCCTCAGTGACAAGGGCTCTGGAGACAGCTCTCAGATTACTCAAGTCAGTCCCCAGAGGATTGCGCTCCGGCTCCGGCCAGATGATTCGAAGAGTTTCTCCGTCCAGGTCCGGCAGGTGGAGGATTACCCTGTGGATATCTACTACTTGATGGACCTGTCTTACTCCATGAAAGATGACCTGTGGAGCATCCAGAACCTGGGTACCAAGCTGGCTTCCCAGATGCGCAAGCTCACCAGTAACTTACGGATTGGCTTTGGGGCCTTTGTGGACAAACCCGTGTCACCATACATGTACATCTCCCCACCAGAGGCCCTCAAAAACCCCTGCTATGATATGAAGACCACCTGTTTGCCCATGTTCGGCTACAAACATGTGCTCACACTGACTGACCAGGTGACCCGCTTCAATGAGGAGGTGAAGAAGCAGAGTGTGTCACGGAACCGAGATGGCCCAGAGGGCGGCTTTGATGCCATCATGCAGGCGACAGTCTGTGATGAGAAGATTGGCTGGAGGAATGATGCATCCCACTTGCTGGTGTTTACCACTGATGCCAAGACCCATATAGCACTGGATGGAAGGTTGGCAGGCATTGTCCAGCCCAATGATGGGCAGTGTCACGTTGGCAGTGACAACCATTACTCTGCCTCTACTACCATGGATTATCCCTCTCTGGGGCTGATGACTGAGAAGTTATCCCAGAAAAACATCAATTTGATCTTTGCAGTGACTGAAGAAGTAGTCAATCTCTACCAGAACTACAGTGAGCTCATCCCAGGGACCACAGTGGGAGTTCTGTCCACCGATTCCAGCAATGTCCTACAGCTCATTGTTGATGCTTATGGGAAAATCCGCTCCAAAGTAGAGCTGGAAGTGCGTGACCTTCCTGAGGAGTTGTCTCTGTCCTTCAATGCTACTTGTCTCAACAACGAGGTCATCCCAGGCCTCAAGTCTTGTGTTGGACTCAAGATTGGAGACACGGTGAGCTTCAGCATCGAGGCCAAGGTGCGTGGCTGCCCCCAGGAGAAGGAAAAGTCCTTCGCCATCAAGCCTGTGGGCTTTAAAGACAGTCTCACTGTGCAGGTCACCTTCGACTGTGACTGTGCCTGCCAGGCCCATGCCGAGCCTTACAGCCGCCACTGCAACAACGGCAATGGGACCTTTGAGTGTGGGGTGTGCCGCTGTGGGCCTGGCTGGCTGGGATCCCAGTGTGAGTGCTCAGAAGAGGACTACCGCCCCTCGCAGCAGGATGAGTGCAGCCCCCAAGAGGGCCAGCCAGTCTGCAGCCAGCGGGGCGAGTGCCTCTGTGGCCAGTGCGTCTGCCACAGCAGTGACTTTGGCAAGATCACGGGCAAGTACTGTGAGTGTGATGACTTCTCCTGTGTCCGCTACAAGGGGGAGATGTGCTCGGGACATGGCCAGTGCAGCTGTGGGGACTGCCTGTGTGACTCCGATTGGACCGGCTACTACTGCAACTGTACCACACGCACGGACACCTGCATGTCCAGTAATGGGCTGCTGTGCAGCGGCCGGGGCAAGTGTGAATGTGGCAGCTGCATCTGCATCCAGCCAGGCTCCTACGGGAACACCTGTGAGAAGTGTCCCACCTGCCCTGATGCCTGCACCTTTAAGAAGGAGTGTGTAGAGTGTAAGAAGTTCAACCGGGGAACCCTGCTCGAGGAAAATACCTGCAACAGTTACTGTCGTGATGAGATCGAGTCTGTGAAGGAGCTCAAGGACACTGGCAAGGATGCAGTGAATTGTACCTATAAGAATGAGGATGACTGTGTCATCAGGTTCCAGTACTATGAAGACTCCAGTGGAAAGTCTATCCTATATGTGGTAGAAGAGCCAGAGTGTCCCAAGGGCCCCGACATCCTAGTGGTCCTGCTTTCAGTGATGGGGGCCATTCTGCTCATCGGCCTTGCTACTCTGCTCATCTGGAAGCTCCTCATTACCATTCATGATCGGAAGGAATTTGCAAAATTTGAGGAAGAGCGAGCCAGAGCAAAATGGGACACGGCCAACAACCCACTGTATAAAGAAGCCACATCCACCTTCACCAACATCACCTACCGGGGCACTTAATGGCAAAGTAGTCGTCCTCCGATCACTATCAGACTGTCCCAGGATTGTGGGCATCTCTGCTGTCGTGTTTACAGGAGACAATATCTGTGGGGTGGGATTGGGGGCTTGGAGTGGGGTGGGTTGGGAGAATGTCAGTGAGTGGAAGTGTGGGTCTCTGTGCATGTGTGCGTGTGAGTGTGCTGCGTGAGGGGGAATGTATAATTTAAAGCTTGTCACGTGTCCTGGATAAGCAGAGCTCCTCAGCCTTTGTCCTCAGAACACCTCACATTCTTCCTGCTTCACCTCCTGAAGATGACCTAGGTAGCTGAGTGGGTGTTCTTCATTACCTCAGTGAGAAGCCAGCTTTCCTTCACGGGCCATTCTCCCTGAAGAGAAGGGCAGCGCTGAGGCCTCTTGTTCCAGAAAAAGAGACCCAGACTCTATCCTGAGTTTATGGTTCTTGAGCCTGACTCTCAGCAGCTATGGTAGAAACTGCTGGGTTTTGCAGCCTTGTTGTGTCATCTGTACCTCTATCTCCTTCCCTTTCCCTCAGGCTGAAGGAGAAATCAGGGGAGAGTTGAACCATCAGAGTCTGTGCCTTTTCCATCACCTTAGTCCAGCATGGTTCTCTCATAGGGGGAGTCCTTGCTACTTAATTCTTTGATCTGTTGCAAGAGATGATGGCAGGGCCACTCGGGGGCCACGCATGGCTTGGGAGAATGTGCTAGGGCCCCCCCGTTCATAATCATCACCCTTCAGATTTGCCCCATTGGCAGCTCCACCCTAGAGATTTGTTTAGATATGTTTCACCCTTAGACCAGCACCACTTCTTACCTCCTACTCCCACGCTCTCACTGCTGTTGACATTTACTACATGACTGAAAGCTTGGCCTCTGAGGGAGGGTGCTATGGTTAGAGCCAGGGGTCTGGCCCGCCCTTCAGGCCTTCTGCCCCTTGTCCAAGACACCACCGCACATCCAATCTTGTGCTTCTATGTGCTGTGTCCATCTATGGGGCCAACTGCATTTATCTACCTCTGGGATGTCTTGTGAAGGAGTCATTCCCACGGTCTCCGAGTCTGCTGGGCATAAGTGCCAGGGTAGAATGATGGGCCAGTTGTATCAGCCTGTGTGGCCTTTTCTCTTGTGGGCTGGGCAACCTCATTTTAACTCAGTCATTAATCTGAGAGGCCACAAGTACAGTTTTATTTTATTTTTCTCATTGGGGCACCTGAAACCATGATGAGGCTTACTTAAACCAAAGGATATGTATAGAAACACACTTGTATTATATTTGTAATTTTATCTGATGACAAAGAAGGAGAGGAGGAAAAATCCACACAGACTTAGGCTGGATACAGACAGCCCTACTTAGCATCATTCATAGCTCATGATTGCCCGGTCATGGGCTCTGTCATCCTGGATGTCTGTGGCGATGGGTGCATGGACATGCTGGACTTTTCCCTGAGGGGGAGGGAAAGTGGCTATTCTTTTTTTCTAACAATAGCAGTGACTCTATTGGTGTTTCCATTCATTCAACATTAACAAACACCCCCAACCTACAAGAAAAAAGGAAGGGCCTATAAACAGTGGTCTGATGATCAGAAAATCTAAGTCCTGGCCTCATTGTTATAGCTAAGGAATCTTTAACCTTAATTAAAGCAAGTCACTTTCTTTTCCCTGAGGCTCAGTTTTTCTAGTTTGAAAAATGATGGGTTTGGACCAGCCAATCTAGAAGGTCTCTTTCAGTGTCAGCATTCTAAGATGCTGGGACTTGCTGTGATATTGAACATGCAATGAAGATTTTGTGGGATGTTGATATTGTTTGTGTTTTTAGATGGCAGATCTGAAAGACCTGGCTTTGGCAAGAGCAGATGTCATTCCATATCACCTTTCTCAATGAAAAAAAACCTCATTCTATCCTGTCTTAGAGCCCCTTCTCCAACTTTTGTTAGCAGTTACATCTCCTGATGTAGCACTTAAGCTCCAATAAGTTCTTATATCTTAGTTCACTTTGCACTCATTTGCACACACATATTAGAGAGGAGAAATCCAAAAGAAGTAGCTGAAATGTGTATCCTGTATCCAGGTGCTAACCTTGAGAGTAAGCCTTGGAATTAGGAATGGGGCAAATGACCGAGCCCTGTCTCACCATGGATTACCCTTTACTGTAGGGGATGGTAATGTAGTGTGAGGATAAAAAGGGAATGGGGAGGGATGATAAGGAATCCAAGAAGTTTAGAACCTAACTATAACCTTTGGCTACTGAGACAAGAGTCCATTAGCATAGTAGTTGGACTTTAGATAGGATGGCTTATATGAAGAGACTATATCAAAGGAGGAAGAATGGGTATGTAAAAGATGAAGACATCAGTAGGAATCCTGTCTGAGCTTCTGGAACGGGGCTCATAGGCATTGAAGCCAGTGCTGTCTGTATGTGGGGAGAACCTATAGCTGAGTTCAGGACAGAACAAACAGCAGTCAGTTTTGGCATCATGTGGGGTGAACATCTAAATAGTATTTTGGCATCAGAAAATATAGCCCAAAGAGATTATTTGTGCCCTGGTCTGCGGCACAAATCTCAGGGTCTGCGGACAATAATGGGAAGCTTTGAACATTCCTGAGAAGTTGTCATACAAGGAGTCATGTTCTTTACTTTTCAGATATTCCTAGACCATCCAAGATTTCAAGAGACTTCTCTTTGTTAAGTATTCCTGGTTGAAATGACCTAAGTGCCTTTCTGACTTCCTAACCACCTCCTCTGTTTGAGTTGTGTAACAGTGAATTAAATGTGTTTTCCAAAAAGAA