Transcript asmbl_20824

Sequence
Transcript Sequence for observation asmbl_20824 of TGE0004149:
GCCGCCCGAGGCTAGCTAAGGAGTCGGCCGCCATTTTGTTCTTCTCGTGGTTCCAGTGGGGAGAGAAGGAGGAAGCAGGGTGCGGGGCGGTCGGGGGGGGACCCGCCGCGGCTGTTGCCACCGCCGCCACCACCGCCTCTGTGCTCGTGGCGTGGGAAAGGAGGCGTGAGTCCCGGGCGCGAGCCGCCGGCGGCGCCGCTACGGGAGGATCGGTGGTGGGAAGGCGATGGCGGATATAGATAAACTCAATATCGACAGCATCATCCAACGGCTGCTGGAAGTGAGAGGGTCCAAGCCTGGTAAGAATGTCCAGCTACAGGAGAATGAAATCAGAGGATTGTGCTTAAAGTCCCGAGAGATCTTTCTCAGTCAGCCTATCCTACTAGAACTTGAAGCACCACTCAAAATATGTGGTGATATCCATGGGCAGTACTATGATTTGCTTCGACTTTTTGAGTACGGTGGTTTCCCACCCGAAAGCAACTACCTGTTTCTTGGGGACTATGTGGACAGGGGGAAGCAGTCATTGGAGACTATCTGCCTTTTATTGGCGTACAAAATCAAATATCCCGAGAATTTTTTTCTTCTCAGAGGAAACCATGAATGTGCCAGCATCAATAGAATTTATGGATTTTACGATGAATGTAAAAGAAGATATAACATTAAACTATGGAAAACTTTCACAGACTGCTTTAATTGTTTACCAATAGCAGCCATCGTGGATGAGAAAATATTTTGCTGTCATGGAGGTTTATCACCAGATCTTCAATCTATGGAGCAGATTCGGCGAATTATGCGACCAACTGATGTACCAGATCAAGGTCTTCTTTGTGATCTTTTGTGGTCTGACCCCGATAAAGATGTCTTAGGCTGGGGTGAAAATGACAGAGGAGTGTCCTTCACATTTGGTGCAGAAGTGGTTGCAAAATTTCTCCATAAGCATGATTTGGATCTTATATGTAGAGCCCATCAGGTGGTTGAAGATGGATATGAATTTTTTGCAAAGAGGCAGTTGGTCACTCTGTTTTCTGCACCCAATTATTGTGGAGAGTTTGACAATGCAGGTGCCATGATGAGTGTGGACGAAACACTAATGTGTTCTTTTCAGATTTTAAAGCCTGCAGAGAAAAAGAAGCCGAATGCCACAAGACCTGTAACACCTCCAAGGGGTATGATCACAAAGCAAGCAAAGAAATAGATGTCATTTTGACACTGCCTAGTTGGGACTTGTAACATATAGTATATAACCTTCATTTTTAAAACTGTAATGTGTATTGGTCAGCTTGCTCAAACAGTGTGTTTGTGGGGCCCTCCCTTCCATTTTTGACTTAATGAATGGCATTTGCTGGTTATAACAGCAAATGAAAGATTCTCTACTCCCAAGAAACAATATTTTGTTTTTAATTCTCTATTCCTTTTACAAACAATTTTAATGATGGTGTTAAAGCTGTATGCCCCAGGATGGTTTATCCTGTCTGAGGGGTAAGTGTACAATTGACCTTTTTTTTTTAATTCAGTACAGCCCATGAATCATGTAAATGCTCGTTTTCTTTAGGATATAAAGAGAGCCCTAGGGTGCTCAATCTGTACATGTTATCGTCATAAAATGCATACTGTTGATACAGACCACTGTGAACATTTTTTTAATTTTAAGATTTTGTTTCAAAGGGATTGCTTATTTCTCTCATTGTCTTGTCATGTACAAATTGGTTTTTATTGCTATCAACATTAGAAGTAACTTTCAACCTTGCCAGCATCACTGGTATAATGTATGTTTAATTAAAGCACACTTTCCTCTACCGAATACTTAAAACGAGAATTAAAGCCATTATTTTAAATGTTTGTGACTCTTTCCTAAAGCCAAAGTTTCTGTTGAAATACGTATTGACACACCCCTAAGAACAAAATGGCATAGTTTTATACCCATGCCGCCTTGTTGGGGATTCAAAAACAGGTTTTTGAGTTAAAATAGCAATTAGTAATATAGTGCAGTTTAAGCTATTAATGATTAAAGTTAATAACATTTTGTACAATTTCCATATAGTCTATTCATTAATCTTTTTACAGTTGCATCAGGCCTGAACCCGTCCATTCAGAAAGCTTCAAATTATAGAAACAATACTGTTCTATACGAGTGACCGATTATGCTTTCTTTGGCCTACACTCTTTATTCTGCGGTGAAATTGAGGCTTATAAGTCAAACAAAGGAACTAACTTACTATCCACCAGTTTATACAGAACTCACAGTATCTATGACTTTTTTAAAACTAAGATCTGTTAAAAAGAAATCTGTTTCAACAGATGACCGTGTATAATACCATGTGGTGAAAGTGAATTCAGACTTATTAAATGATGAACTTGTTAAATCCTCTCAGTGTCTATTTATCAGCACAATACACACAGGAGAACTGTTGATGGCATATTAAATCGATTTTAATGAATAAATGGCTCTGGAAACCA