Transcript asmbl_13615

Sequence
Transcript Sequence for observation asmbl_13615 of TGE0000181:
AGAAGCGCAAGATGGCGACTGCGGCCGAAACCTCGGCTTCAGAACCCGAGGCTGAGTCCAAGGCTGGGCCCAAGGCTGACGGAGAGGAGGATGAGGTTAAGGCGGCTAGGACAAGGAGGAAGGTGTTATCGCGGGCTGTGGCCGCTGCGACATACAAGACCATGGGGCCAGCGTGGGATCAGCAGGAGGAAGGCGTGAGCGAGAGCGATGGGGATGAGTACGCCATGGCTTCCTCCGCGGAGAGCTCCCCCGGGGAGTACGAGTGGGAATATGACGAAGAGGAGGAGAAAAACCAGCTGGAGATTGAGAGACTGGAGGAGCAGTTGTCTATCAACGTCTATGACTACAACTGCCATGTGGACTTGATCAGACTGCTCAGGCTGGAAGGGGAGCTTACCAAGGTGAGGATGGCCCGCCAGAAGATGAGTGAAATCTTTCCCTTGACTGAAGAGCTCTGGCTGGAGTGGCTGCATGACGAGATCAGCATGGCCCAGGATGGCCTGGACAGAGAGCACGTGTATGACCTCTTTGAGAAAGCCGTGAAGGATTACATTTGTCCTAACATTTGGCTAGAGTATGGCCAGTACTCAGTTGGTGGGATTGGTCAGAAAGGTGGCCTTGAGAAAGTTCGCTCCGTGTTTGAAAGGGCTCTCTCGTCTGTTGGTTTACATATGACCAAAGGACTCGCCCTCTGGGAGGCTTACCGAGAGTTTGAAAGTGCGATTGTGGAAGCTGCTCGGCTTGAGAAAGTCCACAGTCTTTTCCGGCGACAGTTGGCGATCCCACTCTATGATATGGAGGCCACATTTGCAGAGTATGAAGAATGGTCAGAAGACCCAATACCAGAGTCAGTAATTCAGAACTATAACAAAGCACTACAGCAGCTGGAGAAATATAAACCCTATGAAGAAGCACTGTTGCAGGCAGAGGCACCAAGGCTGGCAGAATATCAAGCATATATCGATTTTGAGATGAAAATTGGCGATCCTGCTCGCATTCAGTTGATCTTTGAGCGCGCCCTGGTCGAGAACTGCCTTGTCCCAGACTTATGGATCCGTTACAGTCAGTACCTAGATCGACAACTGAAAGTAAAGGATTTGGTTTTATCTGTACATAACCGCGCTATTAGAAACTGCCCCTGGACAGTTGCCTTATGGAGTCGGTACCTCTTGGCCATGGAGAGACATGGAGTTGATCATCAAGTAATTTCTGTAACCTTCGAGAAAGCTTTGAATGCCGGCTTCATCCAGGCCACTGATTATGTGGAGATTTGGCAGGCATACCTTGATTACCTGAGGAGAAGGGTTGATTTCAAACAAGACTCCAGTAAAGAGCTGGAGGAGTTGAGGGCCGCCTTTACTCGTGCCTTGGAGTATCTGAAGCAGGAGGTGGAAGAGCGTTTCAATGAGAGTGGTGATCCAAGCTGCGTGATTATGCAGAACTGGGCTAGGATTGAGGCTCGACTGTGCAATAACATGCAGAAAGCTCGGGAACTCTGGGATAGCATCATGACCAGAGGAAATGCCAAGTACGCCAACATGTGGCTAGAGTATTACAACCTGGAAAGAGCTCATGGTGACACCCAGCACTGCCGGAAGGCTCTGCACCGGGCCGTCCAGTGCACCAGTGACTACCCAGAGCACGTCTGCGAAGTGTTACTCACCATGGAGAGGACAGAAGGTTCTTTAGAAGATTGGGATATAGCTGTTCAGAAAACTGAAACCCGATTAGCTCGTGTCAATGAGCAGAGAATGAAGGCTGCAGAGAAGGAAGCAGCCCTTGTGCAGCAAGAAGAAGAAAAGGCTGAACAACGGAAAAGAGCTCGGGCTGAGAAGAAAGCGTTAAAAAAGAAGAAAAAGATCAGAGGCCCAGAGAAGCGCGGAGCAGATGAGGATGATGAGAAAGAGTGGGGCGATGATGAAGAAGAGCAGCCTTCCAAACGCAGAAGGGTCGAGAACAGCATCCCTGCAGCTGGAGAAACACAAAATGTAGAAGTAGCAGCAGGGCCCGCTGGGAAATGTGCTGCCGTAGATGTGGAGCCCCCTTCGAAGCAGAAGGAGAAGGCAGCCTCCCTGAAGAGGGACATGCCCAAGGTGCTGCACGACAGCAGCAAGGACAGCATCACCGTCTTTGTCAGCAACCTGCCCTACAGCATGCAGGAGCCGGACACGAAGCTCAGGCCACTCTTCGAGGCCTGTGGGGAGGTGGTCCAGATCCGACCCATCTTCAGCAACCGTGGGGATTTCCGAGGTTACTGCTACGTGGAGTTTAAAGAAGAGAAATCAGCCCTTCAGGCACTGGAGATGGACCGGAAAAGTGTAGAAGGGAGGCCAATGTTTGTTTCCCCCTGTGTGGATAAGAGCAAAAACCCCGATTTTAAGGTGTTCAGGTACAGCACTTCCCTAGAGAAACACAAGCTGTTCATCTCAGGCCTGCCTTTCTCCTGTACTAAAGAGGAACTAGAAGAAATCTGTAAGGCTCATGGCACCGTGAAGGACCTCAGGCTGGTCACCAACCGGGCTGGCAAACCAAAGGGCCTGGCCTACGTGGAGTATGAAAATGAATCCCAGGCGTCGCAGGCTGTGATGAAGATGGACGGCATGACTATCAAAGAGAACATCATCAAAGTGGCAATCAGCAACCCTCCTCAGAGGAAAGTTCCAGAGAAGCCGGAGACCAGGAAGGCACCAGGTGGCCCCATGCTTTTGCCGCAGACATACGGAGCGAGGGGGAAGGGAAGGACGCAGCTGTCTCTACTGCCTCGTGCCCTGCAGCGCCCAAGTGCTGCAGCTCCTCAGGCTGAGAACGGCCCTGCCGCGGCTCCTGCAGTTGCCGCCCCAGCAGCCACCGAGGCACCCAAGATGTCCAATGCCGATTTTGCCAAGCTGTTTCTGAGAAAGTGAACGGGACGCTGGGAGACAGGAAATGCCTTACTTCACTCTGGCCCGGCGGACCTCCCACCACCCAGCAGTGCACTGGGGATGGACAGGCCTGGTGTGCTGCGTGCTCGCAACCACAGATGGCTCCTCGGCTTTAGACAGAAAGGGGAAGGGGTTCTAAGTCAAGAGCCTTTCAGTGCTCCCTCATATTGAGGGCAGTGGCAGAAAAGTGACCACTCTGCAGGCTGGGCCCAGGATGTGGTGTCCTGAGATAGTTTTGTATCTTAAAGACTGAGGCACAGAAGCGAAACGAGAACACACTGTTTTTGAGACACAGTTGTCCAAATGTTTCTGGCCAGCTCCGGCCCCTTTTTGTATGACACTTCTCTTCCACCCTGCACAGCACATGTGCCCGTCATTCTTTTAATTTTAAAAGATGAAATGGCAGATGCTAGTAATTCACAGAATGGCCTCTTGTGGGGGTGGGTCTGAGGGAAGTCAGCTATAAAACATTTGCTGGAGTTTTGTTCAATGGGGCTGTGCATTTTTATATTATGTGTTTGTAAATGACATGTCAGCCATTGTTTCATGTTTCCTAAAAGCAGAATATTTGCAACATTTGTTTTGTATAGGAATTATTTGTGCCACCTGCTGTGGACTGTTTTCTTTGCCTAGTGACTAGTGACCTGTGTTGTCTAAACATGAGTTTCAGCCCTTTGGTTTTGTTTAATACCATGTCAAATGCAAACTTCAATTCTCCCCATTTAGCTTTATTAAACTGACGTTCTCTTCAAAACTTCTTGCTG