Transcript asmbl_20740

Sequence
Transcript Sequence for observation asmbl_20740 of TGE0008462:
CGCCGCGTCCGGGATGCTCGCCTGACTGCTGCTGGCTCTGCGCTGAGGGACCCCCGCCACCATGGTCTCCGACGAAGATGAGTTGAATCTTCTAGTCATCATTGTTGATACCAACCCAATTTGGTGGGGAAAGCAAGCATTGAAAGAATCTCAGTTTACTTTATCCAAATGCATAGATGCAGTGATGGTGCTGGGAAATTCTCACTTATTCATGGATCATTCCAACAAACTTGCTGTGATAGCAAGTCATATTCAAGAAAGTCGATTCTTATATCCTGGGAAGAATGGCAGACTTGGGGACCTCTTCGGGGACCCCAGCAACCCTCCATCTGAATTTAATCCCTCGGGGAGTAAAGACGGAAAATATGAGTTGCTCACAGCAGCCAATGAAGTTATCGTTGAAGAGATTAAAGATCTAATGACCAATGGTGACATTAAGGGTCAACATACAGAAACTCTGCTGGCAGGGTCCCTCGCCAAAGCTCTTTGCTACATTCACAGGATGAACAAGGAGGTTAAAGATAATCAAGAAATGAAGTCAAGGATATTGGTGATCAAGGCCGCGGAGGACAGCGCGTTGCAGTATATGAACTTCATGAACGTCATCTTCGCAGCTCAGAAACAGAACATTCTGATCGATGCCTGCGTCTTAGGCTCTGATTCGGGACTCCTTCAGCAGGTACGTGTAAACGAGCGCGTGGCGGGGGCGTGAAGCGTGGTGGTTCTGTTCCCTGTCGTGAAAT