Transcript asmbl_20641

Sequence
Transcript Sequence for observation asmbl_20641 of TGE0004130:
GTTGACTGAAGCGAGCGAGCCGGGCTCCAGAGCGTCGAGGCGGAATCTCGGGCCCCCTGGAGTTGCAGCGGCTGCTCTGAGGCCAGCGCAGACATGGCTCACCTCAGGGGCTTCGCCAACCAGCACTCACGCGTGGACCCCGAGGAGCTCTTCACCAAACTGGACCGCATCGGCAAGGGCTCCTTCGGGGAGGTGTTCAAGGGCATCGACAACCGCACCAAGGAGGTGGTGGCCATCAAGATCATCGACCTGGAGGAGGCCGAGGACGAGATCGAGGACATCCAGCAGGAGATCACTGTGCTCAGCCAGTGCGACAGCCCCTACATCACCCGCTACTTCGGCTCCTACCTCAAGAGCACGAAGCTGTGGATCATCATGGAGTACCTGGGCGGCGGCTCCGCGCTGGACCTGCTGAAGCCGGGCCCCCTGGAGGAGACCTACATCGCCACCATCCTGCGGGAGATTCTCAAGGGCCTGGACTACCTGCACTCAGAGCGAAAGATCCACCGAGACATCAAAGGTCCCCGGGCTCGCCTCCTCTCCTGGCCCTCGAGCCCGCCAACCCTGGACAGGCCAGGGTGTGAGGTGGCAGGCGGCTGTGCGGGGCACGCGGCTGGTGGGGCTGGGGGCCTCGCAGCTCCGCGCTCCTGGCCTTTATCCCCTGCGGCCACCGGACACTGATGGCAGAGACGCTGGCGCCACGCCCTCATGCACCGGGAATGCCAGCCGTCTCCTGCTGGGAGAGCCACCGCACTGTGGGTTGGCCCTGCCGAGTCCCTGGGGAGGGGTCAGGGCCACCTGCATGCTGGCGTGGAAGGCAGGCCCGGGGAGGGCCCCTCACGCTTGCGGGCGCCCCCGGCAGTGCCCTGGCCTGGGCCTGTCTCTGGGCCGTGGGGGGAGGCAAAGCTGAGTGAGGCTCCACCAGCAGGTGCTGCTTCAGGCAGCTGCTCGCGGTGGGGTCTCCCTGGCTCAGAGCATGATGCCTCGCTGTCCTGTATCAAGCAGCTGCCAATGTGCTGCTCTCGGAGCAAGGCGACGTGAAGCTGGCGGACTTCGGGGTGGCAGGGCAGCTCACGGACACGCATATCAAGAGGAACACGTTCGTGGGCACCCCGTTTTGGATGGCGCCCGAGGTCATCAAGCAGTCAGCCTACGACTTCAAGGCTGACATCTGGTCACTGGGGATCACGGCCATTGAACTGGCCAAAGGTGAGCCTCCGAACTCTGACCTCCACCCCATGCGCGTCCTGTTCCTGATCCCCAAGAACAGCCCGCCCGTGCTAGAGGGCCACCACAGCAAGCCCTTCAAGGAGTTTGTGGAGGCCTGCCTCAACAAGGACCCCCGATTCCGGCCCACGGCCAGAGAGCTCCTGAAGCACAAGTTCATCACGCGCTACACCAAGAAGACGTCCTTCCTCACCGAGCTCATCGACCGCTACAAGCGCTGGAAGTCTGAGGGCCACGGCGAGGAGTCCAGCTCAGAGGACTCTGACATTGATGGGGATGCTGAGGATGGGGAGCAGGGCCCCATCTGGACGTTCCCCCCCACCATCCGGCCAAGCCCGCACAGCAAGCTGCACAAGGGGTCAGCGCTGCACGGCCCCCAGAAGTCTGCTGAGCCTGCCAAGAGGCAGCCGAGGTCCCAGTGCCTGTCCACGCTGGTCCGGCCTGTCTTCGGAGAGCTCAGAGAGAAGCACCGGCAGAGCGGTGGGGGCGTGGGGGCGCTGGAGGAGCTGGAGAACGCCTTCAGCCTGGCCGAGGAGTCCTGCCCCGGCATCTCGGACCAGCTGATGGCCCACTTGGTGGAGCGGGTGCAGCGGTTTTCACACAACAGAAACCACCTGACGTCCAGCCGCTGAAGCCGCCGTGGACGGGGAGCGGGCAGGGTGGCCTTCGTTTTGAGCTCTGTAGGGTCCTCGCTGACTTGGAGCCCTTTGCACCGTGTCACGGCCTCACCGCTGGGTCTCAGCCCCTACCCTGTGCGGAGGGCTGTCCCCCGTCCCTTCCTGGCTGGGCTGAGGTTACAGCTGGCAGCAGAGACCCCCTGGAGAACCAAGTGACCCTGTGGGGGCAGCGGGCTCGGTCCCCTCAGGCCTCCTTGGCAGGGCCGTCCCCTCCCCCAGGCTCACTGGGTGCAGCTGCTTGGATGGGGGTGTGGAGCCTGTCAGCCCAGCCCTTCCCTTGCCCAGGGCCATAGTGGCCGTGGATTTGCCTTGTGGTGTGAGACCAGGTGCCGTGTCTTCTCGTAAGCGCACGCGTCAGCCAGAACATTTTGTATTTTAAGAAAACTGAACTCTGCTTTCCTGTATCTTCCGAAGTTAAGGTGTTGGTCTCACGGGACGTGGAGAGGCTCCTGCCCCTTTCAATAAACACCTGAATTGAG