Transcript asmbl_20622

Sequence
Transcript Sequence for observation asmbl_20622 of TGE0004126:
GGGAGGAGTTCATACAAGTGCGCAGTGCCAGCTGCAGCAGTACGGCCCTTTGGCGTTCATCCTTGGCGACAGGACGACCAAAAAGCTGACAGAACGCAGCAGAGTGATAACCGTCGATGGCAATATATGTTCCGGGAAGAGCAAGCTTGCGAAGGTGGTAGCGGAGAAGCTAGGCTTGAGGTACTTTCCTGAAGCCGGGATCCATTATGCGGACAGCACCACGGGGGACGGAAAGCCGCTCGACGTGGAGCTCAGTGGCAACTGCAGCTTGGAGAAGTTCTACGACGACCCGAAAAGCAACGACGGCAACAGTTACCGCCTGCAGTCCTGGCTGTACGCCAGCCGCCTCCTGCAGTACGCCGACGCCTTGGAGCACCTGCTGAGCACAGGACAGGGCGTCGTGCTGGAACGCTCCATCTTCAGCGACTTCGTCTTCGTGGAGGCCATGTACAGCCAGCACTTCATCCGGAAGCAGTGTGTGAACCACTACTACGAGGTGAAGAAGGTCACCATCCGGGAGTACCTGCCCCCCCACGTGGTCATCTACGTCGACGTGCCCGTTCCAGAGCTCCAGAGCCGGATTCAGAAGAAGGGAGACCCACACGAGATGAAGATCTCCGCCGCCTACCTTCAGGCCATCGAGAATGCCTACAAGAAAACCTTCCTCCCTGAGATGAGTGAAAAATGCGAGGTCTTAGTGTATAGTGCGAATGAAGCTCAAGATGCGGAAAAGGTGGTGGAGGATATCGAATACCTCAAGTATGACAGAGGGCCGTGGCTCAACCAGGACGACCGTACCTTCCACATTCTGCGGATGCTGGTTCAGAATAAGTTGGAGGTGCTGAACTACACAACCATCCCGGTCTATCTCCCAGAAATCACGATCGGAGCTCACCAGAGTGACAGAGTCTTCCAGAAGTTCGTCGAGCTGCCAGGCCGCAGGTACAGCCCCGGGTACAACGCGGACGTGGGTGACAAGTGGATCTGGCTGAAGTGACGGCACGGCCTCCGCCAGAGCCGCTCCGTGGGACGCAGACGCCCGGCCGGCCGACCCGCACACTGTGGCTTTAGAACTGGGGGGAGTAGACGGTCCGAAATCGCAGGGTGCGGCAGCGGCACAGAGCAGGTGCCCGCAGGGTCGTCGGGGTGGGGGGACCTCGCCACCTCACTGTGGAGTAAGCACCGTTGTCGCGAGGGGAGCGCGGTCTGCGGGAGAGACGGGCGCCACCGGCACAGCCCCCCCGGCTCCCCTCGCGCTGTCGGGCACGTTTGTATGTCGCTCCCTCAGACTTGGAGAAATACAGC