Transcript asmbl_2026

Sequence
Transcript Sequence for observation asmbl_2026 of TGE0004118:
CAGAGCCTGGCTCAGCTAGAGAATCTGTGCAAACAGCTGTATGAAACCACAGATACAACCACTCGACTCCAGGCAGAAAAAGCCTTGGTTGAATTCACCAACAGCCCTGATTGCCTGAGCAAGTGCCAGCTACTCCTTGAAAGAGGAAGTTCATCGTATTCCCAGTTACTGGCAGCTACATGCCTTACAAAGCTTGTATCACGCACAAACAACCCTCTACCATTGGAACAACGAATAGATATTCGAAATTATGTGCTCAACTACCTTGCCACTCGGCCAAAGTTGGCTACTTTTGTGACACAAGCACTAATTCAGTTATATGCCAGAATCACAAAACTGGGCTGGTTTGACTGTCAGAAGGATGACTATGTCTTCAGAAATGCAATCACAGATGTCACAAGGTTTTTACAGGATAGTGTTGAATACTGCATCATTGGCGTCACAATTTTATCTCAGCTAACCAATGAAATTAATCAAGCAGACACCACCCATCCTTTAACCAAGCACAGAAAAATAGCCTCTTCTTTCCGAGATTCATCATTATTTGACATCTTCACACTTTCCTGCAATTTACTAAAACAGGCTTCGGGAAAGAATCTAAACTTGAATGATGAAAGCCAGCATGGTTTACTCATGCAACTGCTCAAACTCACTCATAACTGCCTAAACTTTGATTTCATCGGCACTTCTACTGATGAGTCCTCAGATGACCTGTGCACAGTACAGATCCCCACCAGCTGGAGATCAGCATTCTTAGATTCTTCAACTCTGCAGCTGTTTTTTGACCTGTATCATTCCATCCCTCCTTCATTTTCACCCCTGGTATTATCCTGCTTAGTACAGATTGCCTCAGTTAGAAGATCCCTGTTTAACAATGCAGAGAGAGCCAAGTTTCTCTCTCATCTTGTTGATGGTGTTAAACGAATACTGGAAAATCCACAGAGTTTATCAGACCCAAACAATTACCATGAGTTTTGCAGACTACTGGCCCGACTGAAGAGTAACTATCAACTGGGAGAGTTAGTAAAGGTGGAAAACTACCCTGAGGTCATCCGATTGATAGCTAACTTCACAGTGACCAGTCTACAGCACTGGGAATTTGCCCCAAATAGTGTGCACTATCTCCTGAGCCTATGGCAGCGGCTGGCAGCCTCTGTGCCATACGTGAAAGCCACAGAGCCCCACATGCTGGAAACTTATACTCCTGAAGTCACCAAAGCCTACATCACATCCCGTTTGGAATCTGTGCATATCATATTGAGAGATGGACTGGAAGATCCTCTGGAGGATACAGGTCTGGTCCAGCAGCAGTTGGACCAGCTGTCTACAATTGGACGTTGTGAATACGAGAAGACGTGTGCGCTCCTCGTGCAGTTGTTTGACCAGTCGGCCCAGTCCTATCAGGAGCTGCTACAGAGTGCCAGCGCAAGCCCAATGGATATTGCAGTGCAGGAAGGGAGGCTGACATGGCTGGTTTACATCATTGGCGCAGTAATAGGTGGCCGGGTCTCTTTTGCCAGCACTGATGAGCAAGATGCTATGGATGGCGAGCTTGTCTGTCGGGTGCTCCAGCTGATGAACCTAACAGATTCTCGCTTGGCTCAGGCAGGCAACGAGAAGCTAGAACTGGCCATGCTGAGCTTTTTTGAACAGTTTCGTAAGATCTACATTGGGGACCAGGTGCAAAAATCCTCTAAGCTGTACCGACGACTCTCAGAAGTTCTGGGCTTAAATGATGAGACCATGGTCCTGAGTGTCTTCATTGGAAAAATCATCACCAACCTGAAGTACTGGGGCCGCTGCGAGCCAATCACCTCCAAGACGCTACAGCTTCTCAATGACCTCTCCATTGGATACAGTAGTGTAAGGAAACTAGTGAAGCTTAGTGCGGTACAGTTCATGCTGAACAATCACACGAGCGAGCACTTTTCATTTTTGGGTATTAACAATCAGTCCAACCTGACAGACATGCGGTGTCGGACGACCTTCTACACAGCACTTGGGCGTCTCCTCATGGTGGATTTAGGAGAGGATGAAGATCAGTATGAACAATTCATGCTTCCACTCACAGCAGCGTTTGAGGCTGTAGCCCAGATGTTTAGCACGAATAGTTTCAATGAGCAAGAGGCGAAGCGAACTCTAGTTGGCCTAGTAAGAGACCTGAGAGGAATAGCTTTCGCCTTCAATGCCAAGACCAGCTTCATGATGCTGTTTGAATGGATATACCCATCCTACATGCCAATTCTCCAGCGCGCAATTGAGCTATGGTACCATGATCCAGCCTGTACCACACCCGTGCTCAAGCTGATGGCTGAATTAGTTCATAATAGATCCCAGCGACTCCAGTTTGATGTCTCTTCCCCCAATGGCATCTTACTCTTCAGAGAAACCAGCAAGATGATAACAATGTATGGCAATCGCATCCTGACACTAGGAGAGGTCCCAAAGGATCAGGTCTATGCACTGAAGCTCAAGGGCATCTCCATCTGCTTCTCTATGCTGAAGGCTGCTCTCAGTGGGAGTTATGTCAACTTTGGAGTCTTCCGTCTCTATGGAGACGATGCCCTGGACAACGCTCTCCAGACCTTCATCAAGCTGCTCCTCTCCATTCCCCACAGCGACCTCCTGGACTACCCCAAGCTCAGCCAGTCTTACTACTCACTGCTGGAAGTCCTGACCCAGGACCACATGAACTTCATTGCAAGCCTGGAACCTCACGTCATCATGTATATTCTCTCTTCCATATCTGAAGGACTCACTGCACTTGACACCATGGTTTGTACAGGCTGCTGCTCCTGCCTGGACCACATCGTGACATACCTCTTTAAGCAGCTGTCACGTAGCACCAAGAAGAGGACAACACCCCTGAACCAGGAGAGTGACCGCTTTCTGCATATCATGCAGCAGCATCCAGAGATGATCCAGCAGATGCTGTCAACGGTGCTGAACATCATCATCTTCGAAGACTGTAGGAACCAGTGGTCTATGTCCCGACCGCTACTGGGCTTGATACTACTTAATGAAAAGTATTTTTCTGACCTAAGGAACAGTATCGTGAACAGCCAGCCACCAGAGAAGCAGCAGGCTATGCATCTGTGTTTTGAAAACCTGATGGAAGGCATAGAGCGAAATCTTCTCACAAAAAACAGAGACAGGTTCACCCAGAACCTGTCAGCATTCCGTCGAGAAGTCAACGACTCGATGAAGAACTCCACTTACGGCGTGAATAGCAATGACATGATGAGCTGACACCTCCTTGGAATCTACCTGTACAGAGCAGCGTCCCTTCGGTCTGGCCCAGAGGGGCGAACAATTACAAGGGAGAGGGCCTGGCTGATCCTGGCGCCCTTCTCCAGGGGTGTGGAGAAAATGGCAAAGGTCAACTAGCTGTTTCCCCAGGGAATAGGGGTGTGAG