Transcript asmbl_19991

Sequence
Transcript Sequence for observation asmbl_19991 of TGE0015029:
GTGGCTGCAGTTGGCAAGATGGCGCCGGTGGGGGTGGAGAAGAAAGTGCTGCTGGGCCCCAACGGGCCCGCTGTGGCGGCCGCCAGTGACCTGACCAGCGAGGAGGAGGAGGGCCAAAGCCTATGGTCCTCGATCCTGAGCGAGGTGTCCACCCGCGCCAGGTCCAAGCTGCCGTCCGGCAAGAATATCCTGGTTTTCGGTGAAGATGGTTCTGGTAAAACAACTCTCATGACTAAACTACAAGGAGCTGAGCATGGCAAAAAAGGAAGAGGCCTAGAGTATCTCTACCTCAGCGTCCATGATGAGGACCGAGATGATCACACGCGCTGTAACGTGTGGATTCTGGATGGAGACCTGTACCACAAAGGCCTTCTGAAGTTTGCAGTTTCTGCTGAATCCTTGCCGGAGACGCTGGTTATTTTTGTTGCAGACATGTCTAGGCCTTGGACTATGATGGAATCTCTACAGAAATGGGCTAGTGTTTTACGTGAGCACATTGATAAAATGAAAATTCCACCAGAAGAAATGAGGGAGCTGGAACGGAAGTTTGTGAAAGATTTTCAAGACTATGTTGAACCTGAAGAAGGTTGTCAAGGTTCCCCACAGAGAAGAGGGCCTCTGACCTCGGGTCCTGATGAAGAAAATGTTGCCCTGCCTCTTGGTGACAATGTGCTGACTCATAACCTGGGAATCCCCGTGTTGGTGGTATGCACAAAGTGTGATGCGGTGAGTGTCCTGGAGAAGGAGCATGATTACAAGGAGGAGCACTTTGACTTCATCCAGTCACACCTACGGAGGTTCTGCCTCCAGTATGGAGCTGCCTTGATTTACACATCAGTGAAGGAAGAGAAAAACCTCGACTTGTTGTATAAGTACATTGTCCATAAAACATACGGTTTCCACTTTACCACACCTGCCTTAGTTGTGGAAAAGGATGCAGTTTTTATGTGAGTTCTTTATAGGTGATGCTTTCAAACTCTTTATAGTACATTTGCTC