Transcript asmbl_19982

Sequence
Transcript Sequence for observation asmbl_19982 of TGE0015024:
GAATTTGAGCTGAGAAAACATGCTAGGCAAGAAGGGCGCAGGTACTGTGATCCTGTTGTGTTAACATACCAAGCTGAGCGGATGCCAGAGCAAATCAGATTGAAAGTTGGTGGTGTGGACCCAAAGCAGCTGGCTGTTTATGAAGAATTTGCACGCAATGTGCCTGGCTTCTTGCCTACTAATGATTTAAGTCAGCCCACGGGATTTTTAGCTCAGCCTATGAAGCAAGCTTGGGCAACAGATGATGTAGCTCAAATTTATGATAAGTGCATTACAGAACTGGAGCAGCACCTACATGCCATCCCACCAACATTGGCCATGAACCCTCAAGCTCAGGCTCTGAGAAGTCTTTTGGAGGTTGTAGTTTTATCTCGAAACTCTCGGGATGCCATAGCTGCTCTTGGATTGCTCCAGAAGGCTGTAGAGGGCTTACTAGATGCCACAAGTGGTGCTGATGCTGATCTGCTGCTGCGCTATAGGGAATGCCACCTCTTGGTCTTAAAAGCTCTTCAAGATGGCCGTGCATATGGGTCTCCGTGGTGTAACAAACAGATCACAAGGTGCCTAATTGAATGTCGAGATGAATATAAATATAATGTGGAGGCAGTGGAGTTGCTAATTCGCAATCATTTGGTTAATATGCAGCAGTATGATCTTCACCTAGCTCAGTCAATGGAGAATGGTTTAAACTACATGGCTGTGGCATTTGCTATGCAATTGGTAAAAATCCTGCTGGTGGATGAAAGGAGTGTTGCCCATATTACTGAGGCAGATCTGTTCCACACCATTGAAACCCTCATGAGAATTAATGCTCACTCCAGAGGCAATGCTCCAGAAGGATTGCCCCAGCTGATGGAAGTAGTGCGATCCAACTATGAAGCAATGATTGATCGTGCTCATGGAGGCCCTAACTTTATGATGCATTCTGGGATTTCTCAAGCCTCAGAGTATGATGATCCTCCAGGCCTGAGGGAGAAAGCAGAGTACCTTCTGAGGGAATGGGTGAATCTCTACCATTCAGCAGCAGCTGGCCGTGACAGTACCAAAGCTTTCTCTGCGTTTGTTGGACAGATGCACCAGCAAGGAATCCTGAAGACTGATGACCTCATAACAAGGTTTTTTCGTCTGTGTACTGAAATGTGTGTTGAAATCAGTTACCGTGCTCAGGCAGAGCAGCAGCACAATCCTGCTGCTAATCCCACCATGATCCGAGCCAAGTGCTATCACAACCTGGATGCCTTTGTTCGACTCATTGCACTGCTAGTGAAGCACTCAGGGGAGGCCACCAACACTGTCACAAAGATTAATCTGCTGAACAAGGTCCTTGGTATAGTAGTGGGAGTTCTCCTACAGGATCATGATGTTCGGCAAAGTGAATTTCAGCAGCTTCCCTACCATCGAATATTTATCATGCTGCTCTTGGAACTCAATGCACCTGAGCATGTACTAGAAACCATTAATTTCCAGACACTTACAGCTTTCTGCAATACATTCCACATCTTGAGGCCTACCAAAGCTCCAGGCTTTGTGTATGCCTGGCTCGAACTGATCTCCCATCGGATATTTATTGCAAGAATGCTGGCACATACGCCACAGCAGAAGGGATGGCCTATGTATGCACAGCTACTGATTGATTTATTCAAATATTTAGCACCTTTCCTTAGAAATGTGGAACTCACCAAACCTATGCAAATCCTCTACAAGGGCACTTTAAGAGTGCTGCTGGTTCTTTTGCATGATTTCCCTGAGTTCCTTTGTGATTACCATTATGGATTCTGTGATGTGATCCCACCTAATTGTATCCAGCTAAGAAATCTGATACTGAGTGCCTTCCCAAGAAACATGAGGCTCCCAGACCCATTTACTCCCAATCTGAAGGTGGATATGTTGAGTGAAATTAATATTGCGCCCCGGATTCTCACCAATTTTACTGGAGTGATGCCACCTCAGTTCAAAAAGGATTTGGATTCCTATCTTAAAACTCGATCACCGGTCACTTTTCTATCTGATCTGCGCAGCAACTTACAGGTGTCCAATGAGCCTGGCAATCGCTACAACCTCCAGCTCATCAATGCACTGGTGCTCTATGTAGGGACTCAGGCCATTGCACACATCCACAACAAGGGCAGCACACCTTCAATGAGCACGATCACCCACTCGGCTCACATGGACATATTCCAGAACCTGGCTGTGGACTTGGACACTGAAGGCCGGTATCTCTTTTTGAATGCAATTGCAAATCAGCTGCGGTACCCAAATAGCCACACTCACTACTTCAGCTGCACCATGCTGTATCTCTTTGCAGAGGCCAACACTGAAGCTATCCAAGAACAGATCACAAGGGTTCTCTTGGAACGGTTGATTGTAAATAGGCCACATCCTTGGGGTCTTCTTATTACCTTCATTGAGCTGATTAAAAATCCAGCATTTAAGTTCTGGAACCACGAGTTTGTACACTGTGCCCCAGAAATTGAAAAGTAAGTTAAAATTTTTTAATTGTAGGAGAATGAGAATAATTTGAAGGGTCCAGCCAGGGTGGGTGATTAGAAGGTAGTAGTTGCCAAAGCTAATGAGACAGAAGCTATTGTCAGGCCTGAACTTTTCTGTAACTGTCTCCC