Transcript asmbl_1997

Sequence
Transcript Sequence for observation asmbl_1997 of TGE0015021:
GGTGAGGGCTCCCGGGGCATCTGTACCCCTAACAGTCACTTGTATCTCAAGGTTTATGCTGTAAAGACTGTGCTGCAGAGACCTCTAAGCCTGATCCAGGGACCACCAGGCACGGGGAAGACAGTAACCTCAGCCACCATCGTCTACCATCTGGCACGGCAGGGCAATGGGCCCGTGCTTGTCTGTGCTCCAAGTAACATAGCTGTGGATCAGCTGACGGAGAAGATCCACCAAACTGGGCTGAAAGTTGTGCGGCTCTGCGCCAAGAGCCGCGAGGCCATCGACTCCCCGGTGTCATTCCTAGCCCTGCATAACCAGATCCGGAACATGGATAGCATGCCAGAGCTGCAGAAGCTGCAGCAGCTGAAGGATGAGACTGGGGAGCTGTCATCTGCTGATGAGAAGCGGTACCGAGCCCTGAAGCGCACGGCCGAAAGGGAGCTGCTCATGAATGCGGATGTCATCTGCTGTACGTGTGTGGGTGCGGGGGACCCCAGGCTTGCCAAGATGCAGTTCCGCTCCATTTTAATTGACGAGAGCACCCAAGCCACCGAGCCAGAGTGCATGGTCCCTGTGGTCCTCGGAGCCAAGCAGCTGATCCTTGTGGGTGACCACTGCCAGCTCGGCCCCGTGGTGATGTGCAAGAAGGCGGCCAAGGCCGGGCTGTCTCAGTCGCTGTTCGAACGCCTCGTGGTGCTGGGCATCCGTCCGATCCGCTTGCAGGTCCAGTATCGGATGCACCCTGCGCTCAGCGCTTTTCCGTCCAACATCTTCTATGAGGGTTCTCTGCAGAATGGCGTCACGGCAGCGGAACGTGTAAAGAAAGGGTTTGACTTCCAGTGGCCCCAACCTGATAAGCCGATGTTCTTCTATGTGACCCAGGGCCAGGAAGAGATCGCTAGTTCGGGTACCTCCTACCTGAACAGGACGGAGGCTGCAAACGTGGAGAAGATCACCACGAAGCTGTTAAAGGCAGGTGCCAAGCCAGACCAGATTGGCATCATCACGCCCTATGAGGGGCAGCGCTCCTACTTGGTGCAGTATATGCAGTTCAGTGGCTCCCTGCACACCAAGCTCTACCAGGAGGTGGAGATTGCCAGTGTGGATGCGTTCCAGGGGCGCGAGAAGGACTTCATCATCCTCTCCTGCGTGCGGGCCAATGAGCACCAAGGCATTGGGTTTTTAAACGACCCCAGACGGCTTAATGTGGCCCTAACCCGAGCGCGATACGGGGTCATCATTGTGGGGAACCCCAAGGCCCTATCCAAGCAGCCACTCTGGAACCACCTGCTGAATTACTACAAGGAGCAGAAGGTGCTGGTGGAGGGGCCCCTGAACAACCTGCGAGAGAGCCTAATGCAATTCAGCAAGCCCCGGAAGCTGGTCAACACCATCAACCCTGGAGCTCGCTTCATGACCACAGCCATGTATGACGCCCGGGAGGCCATCATCCCAGGATCAGTTTATGATCGGAGCAGCCAGGGTCGGCCCTCGAACATGTACTTCCAGACCCATGACCAGCTCGGCATGATCAGTGCTGGCCCCAGCCACGTGGCTGCCATGAACATTCCCATCCCCTTCAACCTGGTCATGCCACCCATGCCACCCCCGGGGTATTTTGGACAGGCTAACGGGCCAGCTGCAGGCCGGGGCACCCCAAAAGGCAAAACGGGTCGTGGCGGACGCCAGAAGAACCGCTTTGGGCTTCCTGGGCCCAGCCAGACAAACCTGCCCAGCAGCCAGGCCAGCCAGGATGTGGCATCACAGCCCTTCTCACAGGGTGCCCTGACGCAGGGCTATATCTCCATGAGCCAGCCCTCCCAGATGAGCCAGCCTGGCCTCTCCCAACCTGAGCTGTCCCAGGACAGTTACCTTGGTGATGAGTTTAAGTCCCAGATTGATGTGGCGCTGTCGCAAGACTCCACATACCAGGGAGAGCGGGCATACCAGCACGGCGGAGTGACGGGCCTGTCCCAGTACTAGAAGGTGGCAGCAGAAGAGCTAAGCTATGTGGCTTAGTCCATCAGCATCTTATTCTGGGTAATAAAAAATAAAAATAAATGGATACCTGTTTTCCACTGCTAAAACTGAAGCACCACTGTGAGCAACAGGAGAGGGAGAGGAGCACCCGAGGGAGAGCAGCCCGAGATAGCGAGCGCCCACTGCTGGCACCGCGGCGAGGAGACGAGAGGGAGAGTGGAGGTGGGGCCGGCCCGCCCGCGAGCCCTGCAGCCCGCTCGCCAACGAGGCCCAGCTCGCCGCGTCCATACCTGGGTCTACGACCAGGTGGAGGGAGGAAGACCCTCATCTCAGAGTAGCCCTTTCCTCTGTTTTTTCTTTCTTTTTCTCTTTTATTGAAAGGGGACTACGTTTTTGCAGGAATAACTTGCATTTCTGTGCTGAGCAGGCTCCTTGCAGGTGGCGACCACACCCAGAGAGCCCTGAAGAGTCTCGGGTTCTGTCCGTGCCATCTGAGACCATGCGGTCATGCTGCCTGTGTTCTAAGAGGGTTTTCATTTAAAGAAAATATGGTGTTTTGGGTTTTCTGTTTGTTTTTTTAAAGATTCTTTCAAAGGAGTACTGGAAAATACACTTTACTGAGTTTGTCTCTCAAACCTTAGTGGTGGACCTGGGAAATGCAAGAAGCTTCCAGAAATGAAGTTTAAACGAGCAACACAACGAGGTTAGGATCAACACCTGTGACGCGATCATGGAGAGGATTTTTGTTTTCAGTTTAGCTTCCAGCAGCTTCTCCCTGCGCATCAGGGCAGTGAGGAAGCGCTGCCCCGGCCGATGGGCAGCTCTATGAGCTCTGCTGGACTCCAAGAAGCAAGGTGCTTCCCACGAGCAACGGACTCAGCCCCCCGAGGGACCCCGGCAGGACTGACCATGTGGCCGGAGGGCGGGAAGGTGGCTGTTCCCTGCTGGTGTGGCTTCTCCAGGGTTCTTTGGAGGATTTGGCAGAAGACAGCAGCCAAGAGGAGCCTTTTCCAAGGAGGCGCCCACAGTCACTGTGACTGTCGGACAAGCCAAGCACCATCCCTTCCCTGCCCCATTCTCCACCCCACTCCCAAGTTTGGAGCCCTTCTACCTATGGGCTCAGCTTCAGTGAGGTGGGATGGTTTCTGCTTTTGGGGGAAAAGTTTCAGAAATAAGTTGGTTCTATGCTGAAGGTGCTTGGAGGAGCTTGTCACATCAGCTGGTATAGGGGCATTGGTGTGGGTTTGCATTGCAGAAGTTCTGGCTGGGAGAGCCCCCTACCCTTGTTCCTTGCACACCATGGGGGTGTTTGATCATCTCCCTGGTGGCCACCTAGTTGGGGACTGTCCCCTGCCAACCCAGACCCTAGTAACCTTGACCCCCCAGCGTCCCCTCCCTGTGCGCCTGATATTGGCCCTTATCCGAAAGCCTCCAGATGCCAGCTGGTACACAGGAACACACAGGCACCTTCCTTCTGGCAAGGCCTCTTATTTATCCCATTGCTGTAGGATTTTCAATCCCCTTCTTTTGGTAGGCAGCCTAGAGGCATCTGGCTTGAATAGGCTTCGGCTGTGACCCTGTGCACCCACCCACCACCCTGTTCCTTCCTTGGAGTGCTCTGCCTCACTGTGCTGTTGGCTTTGTTCACCTTCTAGCAGCAATTACTCTTGTGAGTTTTCCAAATCAAAGAGCATCTGTACCAAGGCAGTGTCACTTCTGATTTTTGGTCAATTTGTTTTAAGCTCTTTTGTCACCAATAA