Transcript asmbl_1903

Sequence
Transcript Sequence for observation asmbl_1903 of TGE0015007:
GTCGTGGGGCGTGCCCGGCCTTCCCCAACGCCCGGCAATCCCCGCCGTCGCCGCTGCCGCCTCGGCCCCTGCCGGGGCTTCCCGCAGCCGCCATGTCCGCCAGTGCCGTCTACGTGCTGGACCTGAAGGGCAAGGTGCTCATCTGCCGGAACTACCGCGGTGATGTGGACATGTCAGAAGTGGAACACTTCATGCCCATCCTGATGGAGAAGGAGGAGGAGGGGATGCTGTCGCCCATCCTGGCCCATGGCGGGGTCCGCTTTATGTGGATCAAGCACAACAACCTGTATCTGGTCGCCACCTCCAAGAAGAACGCGTGCGTGTCACTGGTGTTCTCCTTCCTCTATAAGGTGGTGCAGGTATTTTCAGAGTACTTCAAGGAGCTGGAGGAGGAGAGCATCCGCGACAACTTTGTCATCATCTATGAGCTGCTGGATGAGCTCATGGACTTCGGCTACCCCCAGACCACAGACAGCAAGATTCTACAGGAGTACATCACTCAGGAAGGCCACAAACTGGAAACGGGGGCCCCGCGGCCCCCAGCCACTGTCACCAACGCAGTGTCCTGGCGGTCCGAAGGCATCAAGTACCGGAAGAACGAGGTGTTCTTGGATGTCATCGAGTCAGTCAACCTCTTGGTCAGCGCCAATGGCAACGTCCTGCGCAGTGAGATTGTGGGCTCCATCAAGATGCGGGTCTTCCTCTCTGGCATGCCCGAGCTGCGCCTGGGCCTCAACGATAAGGTCCTCTTCGACAACACGGGCCGAGGCAAAAGCAAGTCAGTGGAGCTGGAGGATGTGAAGTTCCACCAGTGCGTGCGGCTGTCCCGCTTCGAGAACGACCGCACCATCTCCTTCATCCCCCCCGACGGCGAGTTCGAGCTCATGTCCTACCGTCTCAACACCCACGTCAAGCCCTTGATATGGATCGAGTCGGTGATTGAAAAGCATTCCCACAGCCGCATCGAGTACATGATCAAGGCCAAGAGCCAGTTCAAGCGGCGGTCAACGGCCAACAACGTGGAGATCCACATCCCTGTGCCCAATGACGCCGACTCGCCCAAGTTCAAGACAACAGTGGGGAGCGTCAAGTGGGTCCCTGAAAACAGCGAGATCGTGTGGTCCATCAAGTCTTTCCCGGGCGGCAAGGAGTACCTGATGCGGGCCCACTTTGGCCTGCCCAGCGTGGAGGCTGAGGACAAGGAGGGCAAGCCCCCTATCAGCGTCAAATTCGAGATCCCCTACTTCACTACCTCTGGCATTCAGGTACGCTACCTGAAGATCATCGAGAAGAGTGGCTACCAGGCCCTGCCCTGGGTCCGTTACATCACTCAGAACGGAGATTACCAGCTCCGGACCCAGTGAGGGGACAGTACCCCAGCTCTGGCATGGGGGCTCCTGGTGGAAGCACTGGGAGGAAGGCCTGCCAAGCCCACCGGAAGGAGGAGGGCACCCCGACACCAGCCACCCTCCCAGCCCTGCTGGGAGACTCCTCCTCCAGGCACACCTGTTCTTTCATCACCACTTGTCGCCAAAGCCCCTTCTCCCAGAAGAGGCTCGTCTTCCAGATGTCCTGTCTCTGCCCCGAGTCAGTCTGGGGAAAAGGAAGTAGAATCTTTCCCCCAGTGGTCACGTGCAGCCTCTGGGCTGTTTACCTCCCAGGCACCAAAAAAGGTCGGGAGACACTTGCCAGGCTGCAGCAGGGCCGCCGCCCCGTTCTGCTGACCGTTTATGAAGCTCCGGGGTTTCATCTTCTTTCATTGCTGTTTGTGTGAACCTCACTGTCTGCGCCTCCTGCCCCTCATCTTGAAGCTTTCGGGCAGCACTTAGGACAGGGTACCCCCTGTTCCTTGACCTCCTCCCACAGTGTGTTGCTCTCCACATGGGGCCAAAACCCAGCACTTTGGCCCCTTGAGGGCTCCTGGCCTGGACCCATAGGCTTTGACAAGGCACATCCCCAGGGCCAGCCTGTGCCACGTGATGTTGTCACGCAGCCACATCTGATGAGGTGGGTGTAGTGAGGGCCGCTGGCCTTGGAGGGTGGGGGGCATGGGTCATCCGCATCTGTGCTTGGTTACCCCCATCTGTGTTCATGTCACGATTACATTAAATTTCAT