Transcript asmbl_18900

Sequence
Transcript Sequence for observation asmbl_18900 of TGE0015001:
GCCCCGGCCCGCCTCGCGTCCGCCTCCTCAGCCCGCGCGCAGCATGGCGCCCCCCCAGGTCCTCGCGTTCGGGCTCCTGCTCGCGGCTGCGACGGCGGCAGTGGCCGCGGCTCAGAAAGAATGTATCTGTGAAAACTACAAACTGACCGCAAACTGCTCTGAGAACAGAGATGGTCAATGCCACTGTATTTCACTTGGTACACAACATTCTGTCATTTGCTCAAAATTGGCTACCAAATGTTTGGTGATGAAGGCAGAAATGTCTCACTCAAAGTTGGGGAGAAGACTAAAACCTGAAGATGCTATCCAAAATAATGACGGGCTCTACGATCCAGACTGTGATGAGAATGGGCTTTTTAAAGCCAAGCAGTGCAATGGCACCACCACGTGCTGGTGTGTGAACACTGCTGGTGTCAGAAGAACGGATAAAGACACTGAAAAATCCTGCTCTGAACGAGTGAGGACCTACTGGATTATCATTGAACTAAAACACAGAACAAGAGAAAAACCTTATGATATTCAAAGTTTACAGACTGCACTCAAGAAGATAATCACAACTCGTTATCAACTGGATCCAAAATATATCACAAATATTCTGTATGAGAATGATCTTATCACTATTGATCTGATGCAGAATTCTTCTCAGAAAACTCAGAATGATGTGGACATAGCTGATGTGGCTTATTATTTTGAAAAAGATGTTAAAGATGAATCCTTGTTCCAGTCTAAGAAAATGGATCTAAGAGTAGATGGGGAACAGCTGGATCTGGATCCTAGTCGAACTGCAATTTACTATGTTGATGAAAAACCACCTGAATTTTCAATGCAGGGTCTAAAAGCTGGTATTATTGCTATCATTGTGGTTGTGACAATAGCAGTTATTGCTGGAATCGTTGTGCTGGTTATTTCCAGAAAGAACAGAACGGCGAAGTATGAGAAAGCTGAGATAAAGGAGATGGGCGAGATGCATAGGGAACTCAGTGGATAAATACTGTAATTTGAATAGTAACTACAAGAAGGGAAATTAGCAAATGGACTCAGATTACAAATATATGAGTGTGAGACAAAGAAATCTTTGAAGACTACTTTTGTTGACATATATTTGTAATGGTGATACCTATATTCAAAATATAAGTAGCTTGAAATTGACTTTACCAATCTTAAAATTTGACCACAAATGTCATATATATGAGATCTGATATCCCAGAATCTTTTAGTCTCAGAACTTTGACTGCATAGTTAAAATTATTTATACATAACACTGAAGAGTCCATTAAATATGCTTCCACAGTAGGTTTTGAATGACTACTATCTCATCCATTTGTGATTAAAACCTGCCTTCCTATTTACTTCGAGTCTTGTACATATACACCTTTTTTATGAACTATAAAATAAAACATTTTAAAAGTTTCCTAATTTTGTTTGAACTATATTGAATCAAATTTCCTAATTATATACATAATATGGTAAGAAATGCTTTGAATGCTAACTAAAAATTAATTTTGCATGAGTACTTCTAATCCTGTATATTCAATATAATATGTATAACATGTAACTGCTACACAGAAAAATATGTTTTATTCTGAACGAATCTGAGATTCTGTTTTAGACAGATTGGCATTTTGGCAGACCCTAACACCTTGAGGCAGATGTGGAGAATGTTGTGAACCAGGAATTCTATGGTTGGTTGGGTTAGAAGTACATTTCCAACATTTTATAAAATGAATAATTATAGTACGAATACATTTTATATGAAGTTAAAGAAATATTTTCCTTTTGATAGAAAATTTAAAAATGTGAAAAGAACATTAAAGAATATGTAAAAAGTAGATTTAAACGTGATTTTTATTCCTTCTATAGTAGGCAGAATTCTAGAATGGACCCCAAGATTTCATACCCCTGATGTATATGCCCTGTGTAGTCTCCTCCCCTAAAGTATGGGCAGGGCCTGTGAATACGATGGGCTGCCAAAATAAATTCCATTATGTGGCAGAGGTGAAGGGATTTTGCAGATGCAATTAAGAATCCTAATCAGTGGACAAAAGGGAGATTACTGTGAGTGGGCTTGACCTAATCAGGTGAGTCTTAAGAGTGTCTAAAATAAAGAGAAAAGAAGTGGAAACAGCAGAAGCGCTCTGTTAGCCTTAAAGCAAACCCCTGTTGTGGAAAGGGTCTCCTGTTAGAAGACAGCAGGCCTTCCAACTCTAGATGCTGAGGGCCTCGGTCCCAGAACCCCAGAAACTGAATTCTGCCAACAACCAGTGAGCTTGGAAGAGGACCCCAGTTCCAGATGACATCAAGCCATGGTGGACATCTTTACCAGTGTTGAGATCTTGAGTAAAAGACCCAGTTATGCTATGCTTGGACTCCTGACCCTTGGAAACTGAGATTAAATGTTTATTGTCTTAAGATGCAAAATTTGTGGCAATTTATGCAGTGATAGAAATTACTATAGCCAGTAGAAAGTAATGAGAACTTTAAAGATAATAGGAATAGATATTTATATGCAC