Transcript asmbl_18833

Sequence
Transcript Sequence for observation asmbl_18833 of TGE0004029:
TGGAGACCTTCAGGCGGAGCGCGGGTCTCTAGGAGCTATGGGGCACGCCCGGGATTTCGTCTGGGCGCTTCTGGGGCTGTGGCTGCTACTGTGCAGCTGGAGTTGCCTCGGGAGCGCCGAGCTGCGTGCTCCGCCGGATAAGATCGCGATTATTGGAGCTGGAATTGGTGGCACTTCGGCAGCCTATTATCTGCGGCAGAAATTTGGAAAAGATGTGAAGATTGACCTGTTTGAAAGAGGAGAAGTTGGGGGCCGTCTAGCCACCATGACTGTGCAGGGGCAAGAATATGAGACAGGAGGTTCAGTCATCCATCCTTTAAACCTACACATGAAGCGCTTTGTCAAAGACCTGGGTCTCTCTGTTGTCCAGGGTTCTGGTGGCCTAATTGGGGTGTATAACGGAGAGAGTCTGGTGTTTGAGGAGAGCAGCTGGTTTATAATTAACATAATTAAACTAATCTGGCAGTATGGATTTCAGTCCCTTCGAATGCACATGTGGGTAGAGGATATATTAGACAAGTTTATGAGGATCTACCGCTACCAGTCTCATGATTATGCCTTCAGTACTGTAGAAAATTTACTGCATTCTCTAGGAGGGGACGACTTCCTTGGAATGCTTAACCGAACACTTCGTGAAACCTTGCAGAAAGCAGGCTTCTCTGAGAAATTCCTCGATGAAATTGTTGCTCCTGTCATGAGGGTCAATTATGGCCAAAGCACAAACATCAATGGTTTTGTGGGGGCAGTGTCACTAGCTGGTGCTGATTCTGGCCTTTGGGCAGTAAAAGGTGGCAATAAACTTATTTGCTCAGGGCTCCTTCAGGCTTCCAAAGGCAACCTTATATCTGGCTCAGTAATGTACATAGAGGAGAAAACACGGACCAAGCAGACAGGAACCCCCGCAAAGATGTACGAAGTGGCCTACCAAACTGGATCTGAGACCCATTCAGACTTTTATGACATCATCGTGGTGGCCACTCCATTGAATCGAAAAATGTCCAATATAACTTTTCTCAACTTTGATCCTCCAATTGAGGAATTCCATCAATACTACCAATATATTGTGACAACTTTAATTAAGGGGAACTTGAATTCCACTATTTTTAGCTCCAGAGCCTTAGGTAAATTTGATCTCAGTACAATCTTAACCACTGATAATTCAGATTTGTTCATTAACAGCATTCGGATTGTGTCCTCTGTAAGAGAAAATAATCCTCAACCATCAGAAGATGGGGCATATGTTTGGAAGATCTTTTCCCAAGAAACTCTTACTAAAGAACAAATTTTAAAGCTCTTTTTGTCCTATGATTATGCTGTGAAGCAGCAGTGGCTTGCATATCCTCACTATAAGCCTCCAGAGAAATGCCCCTCTATCATACTTCACGATCGACTTTATTACCTCAGTGGCATAGAGTGTGCAGCAAGTGCCATGGAGATGAGTGCCATTGCAGCCCACAATGCCGCTCTCCTTGCCTATCACCGCTGGAATGGACATACAGATATGATTGACCAAGAGGATTTATATGAGAAACTTAAAACTGAACTATGAAATAATAACACTTTCACTTTTCCCCCCTCTTGGTTCCCAGTGGAATATCACTGGCAAAAAAGAACACAATCTGAGCAGAGATGTTTTCAAATCACATATTTTGCCATTATTGTTTAACATGAGTAATTCTAGTGTCATGAGAAAATATAAGGATCTCATAAGCGTGAAAGTGTAACTACTGCACTTATCCCATCTCCAAAATTTCTTAACTCTTCTTTTAATACCCATCAGCAGTGTTTCCCAAACTTGTTTGATCGTAAGAATCATTTGAGGTTTGATAAACATATAAAATTCTCTAGCTCTTCTGGAGATTGATTCAGTAGGTCTGGAGATGAGGCCCTGGATTTTGAATAAAATCTTAGAACATTTGAAGCTGAACACTTGAATTAGAACTTAAGACACGTTTTAGTTGGGGACTAGTTTATTTGTACTTCACAGCTGGATGTGATCTTGAGTCAGATAGTTAAAACTGCTGTAGGAGTTGGTATCTTATGCCTGGCTTTAGTAATTTATACTCTTTTTCAAAGTAAATGCCTCACCGAAGCCTTGACTTTCAGAATGTTTTTTTGATTTCTTCTGTCTCATTTTTTAAGGGTGAAATTTGTAAGTCTTAGTAGTATAACTTTAAGATGTCTTACAAAAGTCTCTAGTAAAATGAAAAGCAAATATAGGCTCATTGAAGAAATTGGCATTCAATTATCGAATCCTCACCCACGTATTTAGAAAATACTGATATACCCTATAGATTATTTAATGGACTGAGGATAGGACCTCCGCATTGTAGCTTGTTAAAAGTTCCTGATGTGCAGCCTGGGTCGAGAATCACTGACTTGGAGAGTCTAATATGTTTCCAAAGGGTTTTTCAGTGCCTTCAAAGTCCCAAGAAATCCAATTCATTATCAAAGCAGATGGATTTTGTGAAGAATTTCTCAGAACTCTAGTGGTAACCTTGATAGTAAGCAGCATTGACAGCCTAACAGCAGAGGTAACTTGGATTACTCCAGAGTTGACACAAGTAAGATACTCGTAATGACACCATGCTTGATCAAATCCAGCATATGTCCAAACTGTTAAATGCTTCTAAAGCTACTGGTACCATTTTGGGTGAGAAATTGGTTCCTGAAATCTTTTAATGCGTTAAGTTCTCAACCTTGGCTGCACATTGGAATCTTCTGTTGGACTTTAAAGCTTCCCAAATGATTCTAATATGCAGCCAAGCTTGAGAATCAGTTCTACATCTACTGTATTAAGATCATTAATGACTGTCCTTATAGTCACTGTTAGGACAGAACACATAAAAGCTTGTGAATTCAACAGTAACAGCAACAAAGTTAACATGTACTGTTAAAAAAATTTGTCAAAGGTTTTTTTTTCTAATTTTATTTTTAAAAAGAATGTTGAGGCAATTTTCTTTTCCTTTTGTGGTTTTAATGGACAGTATGCGGAGAATGTAATATACTGTGCTATGTATATGCTAGACTGGTAAATACTAATAGTTAACTTAGAACTTGTTTTGCAATGGGATATATGTCAAGCATATTTGTTTTAATGCAATCATGGTATTAAAGGATATATGTATTTTTTATTGGACAAAAAATACTATCAGAGCTTGTTACTCCAGAAGACCACTCATCCTTTTACAGAAGAGAATGGTAAAGGGCTGAATGAAAGCCAGCTCCACTCTAGTGGTTCTCCGACTTAGGTATGCATCAGACTTACCCGGTGGGCTTGTTAAAACATTTCTGGGCTTACCCCCAGAATGTGTTTTAATAGGGTTTGGGGTGGCATACAAAAATTTGCATTTCTGTTAAGTTCCTAGGTGATGTTCCTGGTCTAGGAACCACACTTAAAAGAGAACTAGTTCTGTAATTCAGCTCTAAGTGGTTGAAAAATTGAAAGCCTGTCAGCTTCAATGAAGATTTAAAAAGAGCTACTGGAGAAGAATGTTAGAATAAAAATGTTGGACTTCACACCAGCTCTCCTTATTGTGATTAGGTTGGTTTGAACCCTCTAGCTGTTCTTTTGCTGTAAATAGGAAATATTATTTTAGAGCTACATCAGGTGTGCTCACTGTATACCCCATTCTCTGCAGTTTTAAAGTGACTCAAGATTTGTAGTATTTTTACCAGATCACAAAAAGAACAGGTCTAGTCATTTACTTGGTAGGTTTCTTAAGGTTAGGCTTATGATACAACCATCTGTATGTAATATAGCTTTCATCAGTTGGTGTGCCCTCAAATGTATGAACTAGATGAATGTATTATGGCAGCATCATCATTACTCTCTATACTTTACAAAGAACAATACACTGGAATGTTTTTCTCTGGAATTCTATTTCTACTCTTGTATTAAAAATTTTTTCCCACTTATGTTCGAAATAAACAACTACATCATTAATTCCTGTTTTACTTTTGTTGTACTATACTTGGAATGTAGATGTACTTGAAAAAGCCAGAGTATATCAAAGTTACCCTAAGAGTT