Transcript asmbl_18495

Sequence
Transcript Sequence for observation asmbl_18495 of TGE0003993:
CTGGAAGCGGAAGAGATTTCGTTTTTCTCTTACGCACTCTCGTGCGTCTCACCTGCGTAGTTTTTGCCCGGCGGGAACGCGCAGCGGGGGAAGTTTGTCTCGGTGAAGGGAAGCTTAACGCTGAGACCCCGGAGCGGCGGCAGCCATGGCGGATGTGACCGCCCGTAGCCTGCAGTACGAGTACAAGGCGAACTCGAATCTTGTCCTCCAAGCTGACCGCTCTCTCATTGACCGTACCCGCCGGGATGAGCCCACGGGAGAGGTGCTGTCCCTGGTTGGGAAGCTGGAGGGCACCCGGATGGGAGATAAGGCTCAACGGACCAAACCGCAGATGCAGGAGGAAAGAAGAGCCAAGCGAAGGAAGCGTGACGAGGACCGGCACGACATCAACAAGATGAAGGGGTACACGCTGCTCTCAGAGGGTATCGACGAGATGGTGGGCATCATTTACAAGCCCAAAACCAAAGAGACCCGGGAGACCTACGAGGTGCTGCTTAGCTTCATCCAGGCTGCCCTTGGGGACCAGCCACGTGATATTCTGTGTGGGGCAGCTGATGAAGTTCTAGCTGTCCTAAAGAATGAAAAGCTTCGTGATAAAGAAAGGAGAAAGGAGATCGACTTGCTGTTGGGTCAGACAGATGATACCAGATACCATGTTCTAGTGAACTTGGGCAAAAAGATCACAGACTACGGTGGAGACAAGGAAATCCAGAACATGGATGACAACATTGATGAAACATATGGCGTGAATGTACAGTTTGAGTCTGATGAGGAGGAAGGTGACGAAGATGTGTATGGGGAGGTTCGAGAAGAGGCCTCCGATGACGACATGGAAGGGGACGAGGCAGTGGTGCGCTGCACCCTTTCGGCTAATCTTGTTGCATCTGGGGAACTGATGAGTTCCAAGAAGAAGGATTTGCACCCTCGGGACATTGATGCCTTCTGGCTGCAGCGGCAGCTCAGTCGCTTCTATGATGATGCCATCGTGTCGCAGAAGAAGGCAGACGAAGTGTTGGAGATCTTGAAGACAGCGAGCGATGATCGGGAGTGTGAGAACCAGTTGGTGCTGCTGCTCGGCTTCAACACTTTCGATTTTATTAAAGTGCTGCGGCAGCACAGGATGATGATTTTGTACTGTACCTTGCTGGCCAGTGCTCAGAGTGAAGCTGAAAAGGAAAGGATCATGGGAAAGATGGAGGCCGACCCAGAGCTCTCGAAGTTCCTCTACCAGCTCCACGAGACGGAGAAGGAGGATCTGATCCGGGAGGAGCGGTCCCGGAGGGAGCGAGTGCGGCAGTCCCGAATGGACACTGACCTGGAAACCATGGACCTGGACCAGGGTGGGGAGGCACTGGCCCCGCGGCAGGTTCTCGACTTGGAAGACTTGGTCTTTACCCAGGGGAGCCACTTCATGGCTAATAAACGCTGTCAGCTTCCAGATGGATCCTTCCGTCGCCAGCGCAAGGGCTACGAAGAGGTGCATGTACCTGCTCTGAAGCCCAAGCCTTTTGGCTCAGAGGAGCAACTGCTTCCAGTGGAGAAGCTGCCCAAGTATGCCCAGGCTGGCTTTGAGGGCTTCAAAACACTGAACCGGATCCAGAGTAAGCTGTACCGGGCCGCCCTGGAGACAGATGAGAACCTGCTGCTGTGTGCCCCCACTGGCGCCGGCAAGACCAACGTGGCTCTGATGTGCATGCTCCGAGAGATAGGGAAGCACATCAACATGGATGGCACCATCAATGTGGATGACTTCAAGATCATCTACATCGCTCCCATGCGGTCTTTGGTGCAGGAGATGGTGGGCAGCTTTGGAAAGCGCCTGGCTACCTACGGCATCACTGTCGCCGAGCTGACGGGTGACCACCAGCTGTGCAAGGAGGAGATCAGTGCCACTCAGATCATTGTCTGCACCCCCGAGAAGTGGGACATCATCACCCGCAAAGGCGGCGAGCGCACATACACCCAGCTTGTGCGGCTCATCATCCTGGATGAGATCCATCTCCTTCATGATGACAGAGGTCCTGTCTTAGAGGCGTTGGTGGCCAGGGCCATCCGAAACATTGAAATGACCCAAGAGGATGTCAGGCTCATCGGGCTTAGCGCCACCCTCCCCAACTATGAGGACGTGGCTACCTTTCTACGCGTTGACCCTGCCAAGGGCCTTTTCTACTTTGACAACAGCTTCCGCCCAGTGCCTCTGGAACAGACCTACGTGGGTATCACAGAGAAAAAAGCCATCAAGCGTTTCCAGATCATGAATGAGATAGTCTATGAGAAGATCATGGAACATGCTGGAAAAAATCAGGTACTGGTGTTTGTCCATTCCCGGAAGGAGACGGGGAAGACGGCCAGGGCTATCCGGGACATGTGCCTTGAGAAGGACACACTGGGCCTATTTCTCCGAGAGGGCTCTGCCTCCACCGAGGTCCTGCGGACGGAAGCCGAGCAGTGCAAGAACCTGGAGCTGAAGGACCTTCTGCCCTATGGCTTTGCCATTCACCATGCGGGCATGACCAGGGTGGACAGGACACTTGTGGAGGATCTCTTTGCTGACAGGCACATTCAGGTTTTAGTCTCCACAGCAACTCTGGCTTGGGGTGTGAACCTCCCTGCACACACAGTTATCATCAAAGGCACCCAGGTGTACAGTCCGGAGAAGGGGCGCTGGACGGAACTGGGGGCTCTGGATATTCTGCAGATGCTGGGACGTGCTGGAAGACCCCAGTACGACACCAAGGGTGAAGGCATACTCATCACGTCTCACGGGGAGCTCCAGTACTACCTGTCCCTCCTCAACCAGCAGCTTCCTATTGAGAGCCAGATGGTGTCAAAGCTGCCCGACATGCTCAACGCGGAGGTGGTACTGGGCAATGTCCAAAACGCGAAGGATGCGGTGAACTGGTTGGGCTATGCCTACTTGTACATACGCATGCTGCGGTCCCCAACCCTCTACGGCATCTCTCACGACGATCTCAAGGGAGACCCCTTGCTGGACCAGCGCCGACTGGACCTGGTTCACACTGCCGCCTTGATGCTAGATAAGAACAACCTGGTCAAGTATGACAAGAAGACGGGAAACTTCCAGGTGACAGAACTGGGTCGTATAGCCAGCCACTACTACATCACCAATGACACGGTGCAGACCTACAATCAGCTGCTGAAGCCCACCCTGAGTGAGATCGAGCTTTTCAGGGTCTTCTCGCTGTCCTCGGAGTTTAAGAACATCACCGTGAGAGAGGAGGAGAAACTGGAGCTGCAGAAGCTGTTGGAGCGGGTGCCCATCCCTGTGAAGGAGAGCATTGAGGAACCCAGTGCGAAGATCAATGTGCTTCTCCAAGCCTTCATCTCACAGCTGAAATTGGAGGGCTTTGCACTGATGGCTGACATGGTATATGTGACACAGTCAGCGGGCCGGTTGATGCGGGCCATCTTTGAAATTGTTCTGAACCGAGGTTGGGCGCAGCTGACAGACAAGACCCTGAACCTCTGCAAGATGATTGACAAACGCATGTGGCAGTCCATGTGTCCTCTGCGTCAGTTCCGGAAACTCCCTGAGGAGGTAGTGAAGAAGATTGAGAAAAAGAACTTCCCTTTTGAGCGTCTGTACGACCTGAACCACAATGAGATAGGGGAGCTCATCCGCATGCCCAAGATGGGCAAGACAATCCACAAGTACGTCCACCTGTTCCCCAAGTTGGAGCTGTCTGTGCATCTGCAGCCCATCACGCGCTCCACCTTAAAGGTGGAGCTGACCATCACGCCGGACTTCCAGTGGGATGAAAAGGTCCATGGTTCATCAGAGGCCTTTTGGATTCTGGTGGAGGATGTGGACAGCGAAGTGATACTGCACCATGAGTACTTTCTGCTCAAGGCCAAGTACGCCCAGGACGAGCACCTTATCACGTTCTTCGTGCCTGTTTTTGAACCGCTGCCCCCTCAATACTTCATCCGTGTGGTGTCTGACCGCTGGCTCTCTTGCGAGACCCAGCTGCCTGTCTCCTTCCGACACCTGATCCTGCCGGAGAAGTACCCGCCTCCCACCGAGCTGCTGGACCTGCAGCCCTTGCCCGTGTCCGCCCTGAGAAACAGTGCCTTCGAGAGCCTTTACCAAGACAAATTCCCCTTTTTCAATCCCATCCAGACACAAGTGTTCAACACCGTGTACAACAGCGACGACAATGTGTTTGTGGGGGCCCCCACCGGCAGTGGGAAGACCATCTGTGCGGAGTTCGCCATCCTGCGGATGTTGCTGCAGAACTCGGAGGGGCGCTGCGTCTATATCACCCCCATGGAGGCACTGGCCGAGCAGGTGTACATGGACTGGCACGAGAAGTTCCAGGACAGGCTCAGCAAGAAGGTGGTGCTCCTGACGGGCGAGACCAGCACGGACCTGAAGCTGCTGGGCAAGGGCAGCATTGTCATCGGTACCCCCGAGAGGTGGGACATCCTCTCTCGGCGCTGGAAGCAGCGCAAGAACGTCCAGAACATCAGCCTGTTCGTGGTGGACGAGGCCCACCTCATCGGGGGCGAGAACGGGCCTGTCTTGGAAGTGATCTGCTCCCGGATGCGCTACATCTCCTCCCAGATTGAGCGGCCCATTCGTGTTGTGGCGCTTAGCTCCTCGCTCTCAAATGCTAAGGACGTGGCCCACTGGCTAGGCTGCAGTGCCACCTCCACGTTCAACTTCCACCCGAACGTGCGCCCCGTGCCTTTGGAGCTGCACATCCAGGGCTTCAACATCAGTCACACGCAGACTCGCCTATTGTCCATGGCCAAGCCAGTGTACCATGCCATCACCAAGCACTCTCCCAAGAAGCCTGTCATCGTTTTTGTGCCTTCTCGTAAGCAGACCCGCCTTACGGCAATTGACATCCTCACCACGTGTGCGGCGGACATCCAACGACAGAGGTTCTTACACTGCACCGAGAAGGATCTGATCCCGTACCTGGAAAAGCTGAGTGACAGCACGCTCAAGGAGACGCTGTTAAACGGCGTGGGCTACTTGCATGAGGGTCTCAGCCCCCTGGAGCGGCGTCTGGTGGGACAGCTCTTCAGCTCAGGGGCCATCCAGGTAGTTGTTGCTTCTCGGAGTCTCTGCTGGGGCCTGAGTGTGACCGCCCACCTGGTGATCATCATGGACACCCAGTACTACAATGGCAAGATCCACGCGTATGTGGACTACCCCATCTATGATGTGCTTCAGATGGTGGGGCACGCCAACCGCCCTCTGCAGGATGACGAGGGGCGTTGTGTCATCATGTGCCAGGGCTCCAAAAAGGATTTCTTTAAGAAGTTCTTATATGAGCCATTGCCAGTGGAGTCTCACCTGGACCACTGTATGCATGACCACTTCAATGCCGAGATTGTCACCAAGACCATTGAGAACAAGCAGGACGCTGTAGACTACCTTACCTGGACCTTTCTGTACCGCCGCATGACGCAGAACCCCAACTACTACAACTTGCAGGGCATCTCCCATCGTCACCTGTCTGACCACTTGTCAGAGCTGGTGGAGCAGACGCTGAGTGACCTGGAGCAGTCCAAGTGCATCAGCATAGAGGACGAGATGGACGTGGCTCCTCTAAACCTGGGCATGATCGCCGCCTACTACTACATCAACTACACCACTATCGAGCTCTTCAGCATGTCCCTGAATGCCAAGACCAAGGTGCGTGGGCTAATCGAGATCATCTCCAACGCAGCCGAGTACGAAAACATCCCGATCCGGCACCACGAGGACAACCTGCTGCGGCAGTTGGCTCAGAAGGTCCCCCACAAGCTGAACAACCCCAAGTTCAATGACCCACATGTCAAGACCAATCTACTTCTTCAGGCTCATCTGTCTCGTATGCAGCTGAGCGCTGAGCTGCAGTCAGATACAGAGGAGATCCTTAGCAAGGCCATCCGGCTCATCCAGGCCTGTGTGGATGTCCTCTCCAGCAATGGGTGGCTCAGCCCTGCTCTGGCAGCCATGGAGCTGGCCCAGATGGTCACCCAAGCCATGTGGTCTAAGGACTCATACCTGAAACAGCTGCCTCATTTCACTTCGGAGCACATCAAACGTTGCACAGACAAGGGAGTGGAGAGTGTTTTCGACATCATGGAGATGGAGGATGAAGAACGGAACGCATTGCTTCAGCTGTCTGACAGCCAGATGGCAGACGTGGCCCGTTTCTGTAACCGCTACCCTAACATTGAGCTGTCTTACGAAGTTGTGGATAAGGACGGCATCCGCAGTGGCGGGCCCGTTGTGGTGCTGGTGCAGTTGGAGCGAGAGGAGGAAGTCACAGGCCCCGTGATTGCGCCTCTCTTCCCACAGAAACGTGAGGAGGGCTGGTGGGTGGTGATTGGAGACGCCAAGTCCAACAGCCTTATCTCCATCAAGAGGCTGACCCTGCAGCAGAAGGCCAAGGTGAAGCTTGACTTTGTGGCCCCAGCCACTGGCGCCCACAACTACACTCTATATTTCATGAGCGATGCTTACATGGGATGTGACCAAGAATACAAGTTCAGTGTAGATGTGAAAGAAGCCGAGACAGACAGCGACTCGGATTGAGTGTGGAGGCCTGTGCTCTTGCCTGGAGGGGTTGGACCTGAACAAAGAGCATGTCTGGGTCACAGTTGTGGACAGTAAGTCTGCTGGCATGAGGGCGGACTGCCAGGCAGTGCAGGTGCACCCCAGGGCCCCTCCACATTTCCTCTTGCCACCTTGGCATCCAAGCTTTGGATCCGGTGTCTGTAGGTGTCGTGTAGCTGTCGTGTTAACTGGATAGCATTTTTAGGCATGTTCTTTGTTTTATTAGGTGTTTTAATAAAATCAGTTGGAGAAATCA