Transcript asmbl_18477

Sequence
Transcript Sequence for observation asmbl_18477 of TGE0003990:
CCGCGTTTGGAGCCGCCGCGGTCCAGTCCTTCTGCCTGCCCGCCTGTTCGCTAGTCCCTCCTGCCGCCCGCCTGCTGGGCAGGGCCGGCCCGGCCCGGCCCGGCCATGGAGTCCTACGATATCATCGCCAACCAGCCCGTGGTCATCGACAACGGTTCGGGAGTGATCAAGGCTGGCTTTGCAGGAGACCAGATTCCCAAATACTGTTTCCCAAACTATGTCGGGCGCCCTAAGCACATGCGGGTGATGGCTGGAGCCTTGGAAGGGGACCTCTTCATGGGACCAAAAGCAGAGGAGCACCGGGGGCTTCTGGCCCTGCGCCACCCCATGGAGCACGGCGTTGTGCGGGACTGGAATGACATGGAGCGCATCTGGCAGTATGTCTACTCCAAGGACCAGCTGCAGACCTTCTCCGAGGAGCATCCTGTCCTTCTAACGGAAGCCCCGCTCAACCCAAGTAAGAACCGGGAGAAGGCGGCAGAGGTGTTTTTTGAGACCTTCAACGTGCCAGCCCTGTTTATCTCCATGCAGGCCGTGCTCAGCCTGTACGCAACAGGACGCACAACAGGAGTGGTCTTAGATTCAGGGGACGGGGTCACCCATGCTGTTCCCATCTACGAGGGCTTTGCCATGCCGCATTCCATCATGCGGGTGGACATTGCCGGCCGCGACGTCTCCCGCTATCTCCGGCTGCTGCTGCGCAAGGAAGGCGTTGACTTTCACACCTCAGCTGAGTTTGAGGTTGTCCGAACCATCAAAGAGCGGGCCTGCTACCTGTCCATCAACCCACAGAAGGATGAGGCTCTGGAGACAGAGAAGGTGCAGTATACTTTGCCGGATGGCAGCATACTCGACGTGGGGCCAGCACGATTCCGGGCCCCTGAGCTGCTGTTCCAGCCGGACCTGGTGGGGGACGAGAGTGAGGGGCTCCATGAGGTGCTGGCTTTTGCCATCCACAAGTCCGACCTGGACCTCCGCCGGACACTGTTCGCCAACATTGTGCTTTCAGGCGGCTCCACGCTGTTCAAAGGCTTTGGGGACCGATTACTAAGTGAAGTGAAGAAGCTTGCACCAAAGGATGTCAAAATCAAGATCTCGGCCCCCCAGGAACGGCTGTACTCCACATGGATCGGTGGCTCCATCCTGGCCTCACTGGACACTTTCAAGAAGATGTGGGTCTCCAAGAAGGAGTACGAGGAGGATGGCGCCCGTGCTATTCATCGTAAAACCTTCTAGCGCCCAAGGAGAAAGGCAGTGTGCTGGGCGAGTGGGAAGAAAGGGGCCAGAGCCCCAACCCTGTCTGGTCTGGGCCCACATACACCAGGCCCAGGGTTCCCTGTGTGCCCTGAACCCCGGGAAGGCGGTACAGCATCTTCCCTGCAGCCCTCCCCTTTGCACACACACGCACACACAGTAACGTTTAGCTGCATGGGTGGGGGTCTTGAGCTGGAACATAGAAATTGATGTGCCCAGCCATAGGTGGTTCTGGGTGTCCCTTTGGCAGGGCCAGTTAGGGCTACGGTTCCTGGCTCTGATCCTTGGGGCTGCTTCTTCCCCAGGCTCCAAGGCTTGACCCCCGAATGCCCCCGTTTCCTCTGACAGGGTCCCTCCCAGGACGAGGGCACCCGGGTGCCTGTGTAATTAGCCTTGGGGAGTGGGATAGAGGAGAAGGTGTCCAGCAGCTCCCCACTGGTGCATCCTTGCTTCTCGTGCCATCTCATCTTCCTGACCCGACAGAGTAGCACAGAGGGCCAGCCACTCCTGGCATAACTGGCCTCCCACACTGTCCCCCTCATCTTCCTGAGTGGATGTCTTTGTGTAGGCTGAGTACTGAGCAGTCTGCTGTCCCCAGTGAGGGGGTCTGACATAGGGTTGCACCCCCTGGAGCCAGGGCAGCAGATGCTTGGGGTTTGGACAGCCAGTCTGTTGCGCTGTCCCTTTCACAGTGCTTCACTGCCTTGCTTCTCCCCTGTCCTTTACCCTGGGCAAGCGTTAGTGGTCTTCCCTTGTTGAGAGTCAGACCCAGAGGGGTGAGGGGAAAGATCTCCTGTCCCACCTCACCCACTGGGAGGGTCATTACCCTGGGCCAGGGCCCCTCCCCGTCCCAGGTATGTACAATAATTTAACACAGTTGCCTGAAGAAAACTTTTTTGTAAATCATTATAGTAATAATTATCAACAA