Transcript asmbl_17699

Sequence
Transcript Sequence for observation asmbl_17699 of TGE0014938:
CGCTGGGGCGCCAGAGATGAGGGGATCCGAGTTGCGGAGAGTGACTCCACCCCATCAGGGGGGCGGGGACAAAGGTGTACCAGTCTGACACTAGATAGATAACCCGAGGGGAGACCTAGGCAGCCCTGGAGGAGGGAAGGGTCCGAATTCAGTGGTCAAGCAGCGAACTTGTATTGCATATGCGCGTCAGTCCTCTGGGCCTTGGCAGTGTCCTGATCAAGTGTCCACCCATCGAACAGGCAACCCTCCCTCATGCACTTGACCCAGCCTCTGACTCACCCGACTAACGGACAAATAGCTGAATCCCACGACTCTATCACTCCAGCTTTTCCCCGCCCCTGACGATTACCGGAAAGTTCTCAGGTCACACCCAAGCCTTACCGGAGAATTGCTAGAAGAGATCCTAGAACTGGTACTGCGTGGGAGGTCCTGATACTGAGCAGAGTGGTCACCTCCTTTCCCAGGTCCCTGCTTCTCTCAGCCTGAGCACCGCCCCACCTCCGTGCCCCAGAACAGCCATGGCTTCCAAGTGCAAGGCGGCTGTGCAGCATGAGGTCCCCGTGAAGAAGAAGCAGCAAGAGGCAGAGGAAGACAGCCTCCACTCCGCTGCCGAGGCCCTCAAGCCTGCATACACAGAGAAGCCTGCAGCCAGAGAGGACTTAACGGGTGAACTCAGCCACAACCCCAAGAACAAGGTAAGCTGCAATCCCCAGCCAGGCCTGGAGTCTGCTCCCTCCTAGGTACAAATATACTCAGTCCGCGCCCCCTCCTCATGGGCGTTTGGCTCTGGCCAGGAAGCTCAAGGCTCCCAAGTAAGCCATGTTCTCCCAAAACCCCAAAGGTCAGGCAGGGCTAGATCCCATCAAATCCAGGATGCGCCCACACAGAATCTCATCGTCGTGTCTGCTCTTTAGACCCCAGAGCAGGCCCCCTGAGCTTCTCGAGCCTCCCCCTGCCACATTTAAGGCAGGGCTCTGACCCCCTCAGCCTCCCCAGGGCTCCCCTATGTCCTCTCTAACCAGCCCCCCAGGGTAGAACCACGTCCTCCTCAGAGATCCCTCACAAGGTAGGGTTGTGTTTCCATCAAACCCCCAAGGCAGAATCCTGACCCCCTCAAGCCTTCCCAGACAGGGCTTCCCCGGTGCAGGCAGACTCCCGTACCCATCAGACCCCTGTCAGTGAGGGGCTGGGCATCCCATACCCCTGGCCTGCCCTCCCCACGCCTCCTCCAGCCCCAGGTGTATGGGAACTACGACTGCCCGCTGCACCTGACTGACATCGAGAAGAACAACAATAAGTTCTACACCATCCGGCTGCTGCAAGAGGGTGACAGCTTCTTCTGCCAGAGGCTCTGGGGCCGTGTGGGAGAGGTGGGCAATTCAGAAACTGAAGAGCCCATGTCACTGGAGGATGCAAAGAAGTGGTTCGAGAAGAAATTTCGGGAGAAAACCAAGAATGCCTGGGCAGAGCGACACCGCTTTAAGCCCCACCCTGGCAAGTACAAGCTTATCGAAGCACACAGAGAGGCTGAGGCCCCGGAAGCTGCGGTGAAGGTGCGGCCCTGCACCCTGGATGCGCCCACACAGAATCTCATCGTCAACATCTCCAGCAAGGACGTGTTCAGAGATGCTATGACCCTCATGAAGCTGGACATAAAGAAGTTGCCCCAGGAAATGCTGAGCCAGCTGCAGATTACACAGGGCTTTGCGGCCTTAGAGAAGCTGGAGGAGGCCCTGAAAGCCCCCACAGATGCTGGCCACAGCCTGAACGAGCTGTCCTCCCGCTTTTACACCATCATTCCCCACAACTTCGGCCGCAAAAAGCCCCCGCCCATTGACTCCTTCAAGCTTCTGCAGACAAAGAAGGACATGCTGCTGGTGCTAGACACCGTCGTCAAGCTGGTCCAGACCCAGGAGGCAGCCCTCGAGGAAGAGGAGGTGGAGGATGTGCCACATCCACTGGACCGAGCCTACCGGCTCCTCAAGTGCCAGCTCCAGCTGCTAGACCAAGAGGAGCCTGAGTACAAGATGATACAAACCTACTTAGGAGAGACTGGCAAGTACTACGAGCGCCTTGGTCTGGACCATGTTTGGAAAGTGAACCGAGACGGGGAGATGAGCGAGAGTACCCCACCGCCCTCCCCTGCCATCACTCAGACTCGCAGTGAGAGAGATAAGCTCCAGGCCCACTCCAAGCTGGACAATTGGAAGCCACTGTGGCATGGCACCAACGTGGCTGTGGTGGCCACCATCCTCAACAATGGGTTCCGCATTACCAAAAGTCTTGTTAGTAAGAGCACCTACTTAGCCTTGGAGAACATTTCTGGCATGTCCTACAAGGATGACCACCATGTCAGCTACATGTTCCTGGGTGAGGAGACACCGGACAGAGAGCACCACACCACCGTCGACGAGCCCAGCGTGAAGCAGCCAGACCCCGGCTTTGACAGCGTCATCGCCCGAGGCCACACAGAGCCACATCTGACCCAGGACACTGAGCTGAAGATGGATGGCCAACGTGTGGTGGTGTCCCAGGCCCAGCCCACGCTCGGCCCAGAGTTCAGAAGCTCTACATTCTCCCAGAGCGAGTACCCCGCCTCCCAGGAGAGCCAATACC