Transcript asmbl_16941

Sequence
Transcript Sequence for observation asmbl_16941 of TGE0014907:
AACTAGAACATAAAGAATAGGAGAACGTGGTGATCACATAGAGGTATTAGAACCACTGATTTCTTTCCTCCTTTTCCCCACCAGAATCCCCTCTCTGCAGGTCTACAGGGAGCCTGCCTTACGGAAACTGTAGAGCTGTTGCAGGCAAAAGTGAGCTCCCTGGACCTTGCAGTTTTGGACCAAGTGGAGGCTCGGCTACAGAGTGTCCTGGGAAAGATGAATGAGATTGCCAAGCATAAAGCTTCTGTAGAGGATGCAGATACACAGAGCAAGGTGCACCAGCTATATGAAACCATACAGCGTTGGAGCCCCATCGCCTCCACCCTTCCTGAGCTGGTGCAGAGACTTGTCACCATCAAGCAGCTACATGAGCAAGCCATGCAGTTCAGTCAGCTCCTGACACACTTGGATACCACACAGCAGATGATAACTAGTTCCCTCAAGGACAATACCACCCTCTTGTCCCAGGTACAGACAACCATGCGTGAAAACCTGTCCACAGTTGAGGGGAATTTTGCCAACATTGATGAACGGATGAAGAAGCTGGGAAAGTGAGCCCCTTTGGAAGATGGAGAACAGGGGTAATGCCTACCCCTTTGAACTCTGTTAACAGCTTACATAGGGTTTCCCCTTAAATATAACTCGCGTATCCCCATCCCATTTGACACTAGGGACAAGGGTTCTTGCATGTGGGGTTTACATCCCTCCTCTGATGACTAGTGTGGTAGCTGGGGGATATTAGATGGTGGTGTCTCCTTGGGCCCCAGGGATGAGGACATGGGCTCAGCCACATGCCAGCTCACGTCTAATACTGCTTTGTCCAGTGTGGGGAAAGATTGGGTCCTGTCCTCCAGCACAGCTTCTGTGGCTGATTGTAACACTGTACAACTGTTTCTGACCATTAAATGCTGTTGTACTCTG