Transcript asmbl_16857

Sequence
Transcript Sequence for observation asmbl_16857 of TGE0003894:
CGGGGCCGGAGCCGGGGGGCGCAGCTAGAGAGCCCCTGAGCGGCGGCGAGAGAGGATCGCACGGCCTCGAGGAGCCCAGGTCCGGCAGCCATGGCGGTGGAAGGAGGAATGAGATGTGTCAAGATCTTGCTCTACGTTTTTCTGGTGGCTTTTTGCGCCTGTGCAGTGGGACTGATCGTTGTGGGTATAGGGGCCCAGCTCGTCCTGAGTCAGACCATCAGCCAGGGGGCCACTCCTGGCTCCGTCTTGCCTGTGGTCATCATCGCAGTGGGTGCCTTCCTTTTCCTGGTGGCTATTGTGGGCTGCTGTGGGGCCTGCAAGGAGAACTACTGTCTTATGATCACGTTTGTTATCTTCCTGTCTCTTATTGTGCTGGTGGAGGTGGCTGCAGCCATTGCTGGCTATGTGTTTAGAGACAAGGTGATGTCAGAATTTAATAAGGACTTCCGGCAGCAGATGAAGAATTATCCAAAACAGAACCAGACGGCTTTGATCCTGGACAGGATGCAGGAAAATTTCAAGTGCTGCGGGGCAGCTAACTACACAGACTGGGAGACCATGCTTCTTGAGCCCAAAGGCCGAGTCCCTGACTCCTGCTGTATCAATGTCACTCAGGGCTGTGGGATTAATTACAATGTGAAGGAGATCTATACCGAGGGCTGTGTGGAGAAGATTGGGTTCTGGCTGAGGAGCAATGTGCTGGTGGTGGCTGCAGCAGCCCTGGGCATTGCCTTTGTGGAGGTCCTGGGAATTGTCTTTGCCTGCTGCCTTGTGAAGAGTATCCAAAGTGGCTATGAAGTGATGTAGGAGGTCTGGTCTCTTCAGCCCCTCTTCTAGGAGGGTGGGGTAATATACTCCATGTTTTTCAATTAAACGGATTATTTTTTCAGACCG