Transcript asmbl_16823

Sequence
Transcript Sequence for observation asmbl_16823 of TGE0014897:
AAGGGTCTGGAGGAGACAGTTGCCCGGGAACTCCAGACCCTCCACAACCTTCGCAAGCTGTTCGTTCAAGACGTCACGACTCGAGTCAAGAAAAGTGCAGAAATGGAGCCCGAGGACAGTGGGGGGATTCACTCCCAAAAGCAGAAGATTTCCTTTCTTGAGAACAACCTGGAACAGCTTACAAAGGTTCACAAACAGCTGGTACGTGACAATGCAGATCTGCGTTGTGAGCTTCCTAAATTGGAAAAACGACTTAGGGCTACGGCTGAGAGAGTTAAGGCCCTGGAGGGTGCACTGAAGGAAGCCAAGGAGGGCGCCATGAAGGACAAGCGCCGGTACCAGCAGGAGGTGGACCGCATCAAGGAGGCTGTTCGGTACAAGAGCTCTGGCAAGAGGGGCCATTCTGCTCAGATTGCCAAACCCGTCCGACCTGGCCACTACCCAGCATCTTCACCCACCAACCCCTATGGTACCCGAAGCCCTGAGTGCATCAGTTATACCAACAGCCTCTTCCAGAACTACCAGAATCTGTACCTGCAGCCTGCACCTAGCACCACCTCAGATATGTACTTTGCAAACTCCTGTACCGGCAGTGGGACCATGTCTTCTGGCAGCCCCTTGGCTTCCTACCAGAAGGCCAACATGGACAATGGAAACGCTACAGATATCAATGACAATAGGAGTGATCTGCCATGCGGCTATGAGGCTGAGGACCAGGCCAAGCTTTTCCCTCTCCACCAAGAGACTGCGGCCAGCTAATCTCCCACTGGACTGCTGCATACCTGCACTTTCAGGTAGCTTCAGGCCGATTCCTCTGACCAGCCTCAGGTTGCCTCCTTTCTTGCCCTCAGCCTATTTATTTCTCCCACTTTTATT