Transcript asmbl_16818

Sequence
Transcript Sequence for observation asmbl_16818 of TGE0014893:
CAGGCGTCCAGTTCTCCCGCATCCCACTGCCGCAGGAGAGAAGTGCGTCCCGGCTCTGCTCCCCAGCCTTCGCCCGGGCGCCCCCAGAGACCGAGCACCTGTCCTTTGCCTCGGCCTCCGGTGAGCTCTCGCCCCCGGAGCACGCACCACCCCTGCCGCTCAAGAAGTGCCCCAGCCCCACGCCGGCGACCACCATGGCGGAGACCAACAACGAATGTAGCATCAAGGTGCTCTGCCGATTTCGGCCCCTGAACCAGGCCGAGATTCTGCGGGGGGACAAATTCATCCCCATTTTTCAAGGGGACGACAGCGTCGTTATTGGGGGAAAGCCATATGTCTTTGACCGTGTATTTCCCCCAAACACGACTCAGGAGCAAGTTTATCATGCATGTGCCATGCAGATTGTCAAAGATGTCCTTGCTGGCTACAATGGCACCATATTTGCTTATGGACAGACATCCTCAGGAAAAACACATACTATGGAGGGAAAGCTGCATGACCCTCAGCTGATGGGAATTATTCCTCGAATTGCCCGAGACATCTTCAACCACATCTACTCCATGGATGAGAATCTTGAGTTCCACATCAAGGTTTCTTACTTTGAGATTTACCTGGACAAAATTCGTGACCTTCTGGATGTGACCAAGACAAATCTGTCTGTGCATGAGGACAAGAACCGGGTGCCATTTGTCAAGGGTTGTACTGAACGCTTTGTGTCCAGCCCAGAGGAGATTTTAGATGTGATTGACGAGGGGAAATCAAACCGTCATGTGGCTGTCACCAACATGAATGAGCACAGCTCTCGCAGCCACAGCATCTTCCTCATCAACATCAAGCAGGAGAACATGGAGACTGAGCAGAAGCTCAGTGGGAAGCTGTATCTGGTGGACCTGGCTGGGAGCGAGAAGGTCAGCAAGACTGGAGCAGAGGGAGCCGTCCTGGATGAGGCAAAGAATATCAACAAGTCACTGTCAGCCCTGGGGAATGTGATCTCTGCGCTGGCTGAGGGCACTAAAAGCTATGTTCCATATCGTGATAGCAAAATGACACGGATTCTCCAGGACTCCCTGGGAGGAAACTGCCGGACAACTATGTTCATCTGCTGCTCACCATCCAGCTACAATGATGCAGAGACCAAGTCTACCCTGATGTTTGGGCAGCGGGCAAAGACTATTAAGAACACTGCCTCAGTGAATCTAGAGTTGACTGCTGAGCAGTGGAAGAAGAAATATGAGAAGGAGAAGGAAAAGACAAAGGCTCAGAAGGAAACAATTGCAAAGCTGGAGGCTGAGCTGAGCCGCTGGCGCAATGGTTAGTGAGGGGACCTGCAGGCACAGGAGACAGGAGGAG