Transcript asmbl_16817

Sequence
Transcript Sequence for observation asmbl_16817 of TGE0014892:
CAGGCGTCCAGTTCTCCCGCATCCCACTGCCGCAGGAGAGAAGTGCGTCCCGGCTCTGCTCCCCAGCCTTCGCCCGGGCGCCCCCAGAGACCGAGCACCTGTCCTTTGCCTCGGCCTCCGGTGAGCTCTCGCCCCCGGAGCACGCACCACCCCTGCCGCTCAAGAAGTGCCCCAGCCCCACGCCGGCGACCACCATGGCGGAGACCAACAACGAATGTAGCATCAAGGTGCTCTGCCGATTTCGGCCCCTGAACCAGGCCGAGATTCTGCGGGGGGACAAATTCATCCCCATTTTTCAAGGGGACGACAGCGTCGTTATTGGGGGAAAGCCATATGTCTTTGACCGTGTATTTCCCCCAAACACGACTCAGGAGCAAGTTTATCATGCATGTGCCATGCAGATTGTCAAAGATGTCCTTGCTGGCTACAATGGCACCATATTTGCTTATGGACAGACATCCTCAGGAAAAACACATACTATGGAGGGAAAGCTGCATGACCCTCAGCTGATGGGAATTATTCCTCGAATTGCCCGAGACATCTTCAACCACATCTACTCCATGGATGAGAATCTTGAGTTCCACATCAAGGTTTCTTACTTTGAGATTTACCTGGACAAAATTCGTGACCTTCTGGATGTGACCAAGACAAATCTGTCTGTGCATGAGGACAAGAACCGGGTGCCATTTGTCAAGGGTTGTACTGAACGCTTTGTGTCCAGCCCAGAGGAGATTTTAGATGTGATTGACGAGGGGAAATCAAACCGTCATGTGGCTGTCACCAACATGAATGAGCACAGCTCTCGCAGCCACAGCATCTTCCTCATCAACATCAAGCAGGAGAACATGGAGACTGAGCAGAAGCTCAGTGGGAAGCTGTATCTGGTGGACCTGGCTGGGAGCGAGAAGGTCAGCAAGACTGGAGCAGAGGGAGCCGTCCTGGATGAGGCAAAGAATATCAACAAGTCACTGTCAGCCCTGGGGAATGTGATCTCTGCGCTGGCTGAGGGCACTAAAAGCTATGTTCCATATCGTGATAGCAAAATGACACGGATTCTCCAGGACTCCCTGGGAGGAAACTGCCGGACAACTATGTTCATCTGCTGCTCACCATCCAGCTACAATGATGCAGAGACCAAGTCTACCCTGATGTTTGGGCAGCGGGCAAAGACTATTAAGAACACTGCCTCAGTGAATCTAGAGTTGACTGCTGAGCAGTGGAAGAAGAAATATGAGAAGGAGAAGGAAAAGACAAAGGCTCAGAAGGAAACAATTGCAAAGCTGGAGGCTGAGCTGAGCCGCTGGCGCAATGGAGAGAATGTGCCTGAGACAGAGCGCCTGGCCGGGGAGGATGCAACCTTGGGAGCTGAGCTCTGCGAGGAGACACCAGTGAATGACAACTCCTCCATCGTGGTGCGTATTGCACCCGAGGAGCGG