Transcript asmbl_15959

Sequence
Transcript Sequence for observation asmbl_15959 of TGE0003840:
TGTGTTTTCAGACCTCCATCTTAATTTGGGACAGACAGCAAAAGACAGCAGCTCTGAAACGCCGCAGGGGACGGAAAACCGCGGCCAGTGCGGCTAGAGCAGGGGCTGGGCCGGAGTGCAGTGGGCGGGGCCCTGGCTCAGCCAATGTCTCGTTGTGGGTGGGGTTATGCGGGGCGGACTGGGCAATAGGACTTCCGGAAATCTGTGCCGGAGCACCCCTGCTTCCTAATCAAAGGTCTTGCGAACACAGACCAGGACGCCGCAGGTTCTTTCTCCGCTGCCACCGCTCGCAAAGCTTTCCCGACCGACATGCCGTTCGTTGAGCTGGACACGAACTTGCCCGCCAACCGCGTGCCCGCGGGGCTGGAGAAGCGGCTTTGCGCAGCCAGCGCCGCCATCCTAGGCAAACCCGAGGACCGCATGAACGTGACGGTGCGTCCGGGCCTGGCTATGGCGGTGAGCGGCTCGGCCGAACCCTGTGCTCAGCTACTTGTCTCCTCTATCGGTGTAGTGGGCACTGCCGAGGATAACCGCGGCCACAGCGCCCGCCTCTTTGAGTTCCTCACCAAGGAGCTGGGACTAGGCCAGGAACGGATAATTATCCGCTTTTTCCCCCTGGAGCCCTGGCAGATTGGCAAGAATGGGACAGTCGTGACATTTTTATGATTGGCATGGAAGACATCCGGGGTATCTGTGAGCTGGCCACCTCTTCCAGAGAGGCCTCCTGGCATAGTGAAGGCCTGGTTGATCCCAGCTTCTGGCATCCCCACATGCAGATATGTCTGTGACCTCACAGTCCTCTTCATCTCCATCCTTATTCCAAATAAATGAAGAGAGCTTTGTCTTTCAAACATTA