Transcript asmbl_15915

Sequence
Transcript Sequence for observation asmbl_15915 of TGE0014854:
CCGTCCTCCATGGCTGCTGTGCTCCTCGCCTGGGCCTGCGGCCCGGTCCGTAGAGCTCTCTGTCGTCAATTACATACTGTCTACCAGTCTGTGAAACTTCCGGAGACACACCAGATACTGCGTCAGACCTGTCGGGACTTTGCCGAGAAGGAGCTGGTTCCCATCGCAGCCCAGGTGGACAAGGAACACCTCTTCCCAGCAGCTCAGGTGAAGAAGATGGGCAAGCTTGGGCTTCTGGCCATCAATATCCCTGAGGAGTTGAGTGGTGCCGGACTCGATTATCTGGCGTACGTCATCGCCATGGAGGAGATCAGCCGGGGCTGTGCCTCCACTGGAGCCATCATGAGTGTCAACAACTCCCTCTACTTGGGGCCCATCTTGAAGTTTGGCTCCAAGGAACAGAAGCAGCAGTGGATCACACCTTTTACCAGCGGTGACAAAATTGGCTGCTTTGCCCTCAGTGAACCAGGGAATGGCAGTGACGCAGGAGCCGCCTCCACCACTGCCCAGGAGGATGGTGACTCGTGGGTCCTGAATGGCACCAAAGCCTGGATCACTAACTCCTGGGAGGCCTCAGCCACCGTGCTTTTTGCCAGCACCAACAGAGCCTTGCACAACAAGGGCATCAGTGCCTTCCTGGTTCCCATGCCGACACCTGGGCTCACACTGGGGAAGAAGGAAGACAAGCTGGGCATCCGGGCCTCGTCCACAGCCAACCTCATCTTTGAGGACTGTCGCATCCCCAAGAACAACCTGCTGGGGGAGCCGGGAATGGGCTTCAAGATAGCCATGCAAACCCTGGACATGGGCCGAATTGGCATTGCTGCCCAGGCTCTGGGCATCGCCCAGGCTGCCCTCGACTGTGCTGTGAACTATGCTATGAATCGCAAGGCCTTTGGGGCGCCCCTCACCAAGTTCCAGGGCATCCAGTTCAAGTTGGCGGACATGGCCCTGGCCCTGGAGAGTGCCCGGCTGCTGACCTGGCGCGCCTCCATGTTGAAGGATAATGGAAAGCCTTTCATCAAGGAGGCAGCAATGGCCAAGCTGGCTGCATCAGAAGCTGCAACTGCCATCAGCCACCAGGCCATTCAGATCCTGGGTGGCATGGGCTACGTGACAGAGATGCCGGTCGAGCGGCACTACCGTGATGCCCGCATCACCGAGATTTACGAAGGCACCAGTGAGATCCAGAGGCTGGTCATCGCGTCGCACCTGCTCAAGAGCTACCAGAGCTGAGCCCTGAGGATTGGGTGGGGGCCAGAGTAACCAGGCCTCAAAGTAGCAGAAGTTGTGCTCTCTCAGGCCTTGTGAAGGCTGTGAGGCTCGGTCATTATTAGAAGCACCGTTAACCTGTTCCTTATAAAACATAAATGAGTGCAGGTGGGTGGTCTGATTCATAGTTTGGGAACTGATTGTAAGTAATAAAGCATACCCGTTCCCCTA