Transcript asmbl_13576

Sequence
Transcript Sequence for observation asmbl_13576 of TGE0000177:
CCCACGAACGCCAAGGCGGCCACGTCCTGCTCCCCCTGGTGAAGAAGCTGCCCTGGGCTTGTCGTCCTAGGGTCTCCAGACATGTCTGAGGTGAAGAGCCGGAAGAAGTCGGGGCCCAAGGGAGCCCCTGCTGCGGAGCCCGGGAAGCGGAGCGAGGGCGGGAAGACCCCCGTGGCCCGGAGCAGCGGAGGCGGGGGCTGGGCAGACCCCCGAACGTGCCTGAGCCTGCTGTCGCTGGGGACGTGCCTGGGCCTGGCCTGCTTGAGTCTACTGAAAGCATCCTGCAGGAAGCTACATCATCCATGTCTTTGATGACCCAGTTTGAGCAGGAAGTATCCAACCTCCAAGATATCATGCATGACATTCAAAATAATGAAGAGGTGCTCACTCAAAGGATGCAAAGCCTTAATGAGAAATTTCAGAATATTACGGATTTCTGGAAGAGAAGCCTAGAAGAAATGAACATTAATACAGACATTTTCAAATCAGAAGCAAAACATATACATTCTCAAGTAACTGTCCAAATTAACTCAGCTGAGCAGGAAATAAAATTGCTCACTGAACGGCTAAAAGATTTGGAAGATAGCACACTAAGAAATATTAGAACAGTAAAAAGACAAGAAGAAGAAGATCTCCTGCGAGTAGAGGAGCAGCTAGGCTCTGATACAAAGGCAATTGAAAAGTTAGAAGAGGAACAGCATGCCCTCTTTGCCAGAGATGAAGATCTGACTAATAAACTTTCCGACTACGAACCCAAAGTTGAAGAATGCAAGACACATTTGCCAACAATTGAAAGTGCTATTCACTCTGTTCTCAGAGTCTCTCAGGATCTGATAGAAACAGAAAAGAAAATGGAAGACTTGACTATGCAGATGTTTAATATGGAAGATGATATGCTGAAAGCAGTGTCTGAAATAATGGAGATGCAGAAAACCCTTGAAGGAATTCAGTATGATAATAGCATATTAAAGATGCAAAATGAACTGGATATTCTAAAAGAAAAAGTTCATGATTTTATAGCATACTCAAGTACAGGAGAAAAGGGAACTTTAAAAGAATATAATATAGAAAATAAAGGAATTGGTGGTGATTTTTAAATTCATGACATTTATTCTGATGAACCATATCATTATACATAAATTGATTAGTCCATTGATTTTGAGTTACTTTGATACGCCTCATCTTATCCTACATTATTGGAAAATAAATGAGATGTCCACACAAATG