Transcript asmbl_15258

Sequence
Transcript Sequence for observation asmbl_15258 of TGE0003793:
TTCACAGTCTGGCTCCGGCGCCGCCCGTCGCGGTCTCGGTTCTGCTCAGCCCGCCTCTGCTCCTGCTCGGCGTCCGGGCTCCCTGTCCGCAGCCATGAACGCTCTCCTCCCGAGTCGAGCCCGCTGTCTTCTAGATTAGTCCCCGCTGCCGTCCCTGGACCGCCTGCACCATGGAGTCGCCCGCCTCGAGCCAGCCTGCCAGCATACCCCAGTCCAAAGGAAAATCTAAGAGGAAGAAGGATTTACGAATATCCTGTGTGTCCAAGCCACCTGTGCCCAACCCTACGCCACCCCGGAACCTGGACTCCCGGACCTTCATCACCATTGGAGATAGGAACTTTGAGGTGGAGGCTGATGACCTGGTGACCATCTCGGAACTGGGACGTGGAGCCTATGGGGTGGTAGAGAAGGTGCGGCATGCCCAGAGCGGCACCATCATGGCTGTAAAGCGGATCCGGGCCACTGTCAACACACAGGAGCAGAAGCGTCTGCTCATGGACTTGGACGTCAACATGCGTACAGTCGACTGCTTCTATACTGTCACCTTCTATGGAGCCCTCTTCAGAGAGGGAGATGTATGGATCTGCATGGAGCTCATGGACACATCCTTGGATAAGTTCTACCGGAAGGTGCTTGATAAAAACATGACGATTCCAGAGGACATTCTTGGGGAGATTGCTGTGTCTATTGTGAGGGCACTGGAGCATCTGCACAGCAAGCTGTCCGTGATCCACAGAGATGTGAAGCCATCTAATGTCCTCATCAACAAGGAGGGCCATGTGAAGATGTGCGATTTTGGGATCAGCGGCTACTTGGTGGATTCTGTGGCCAAGACGATGGATGCTGGCTGCAAGCCCTATATGGCTCCTGAGAGAATCAACCCGGAGCTGAACCAGAAGGGCTACAACGTCAAGTCTGATGTCTGGAGCCTCGGAATCACCATGATCGAGATGGCCATTCTACGGTTTCCTTATGAGTCTTGGGGGACCCCGTTCCAGCAACTGAAGCAAGTGGTGGAGGAGCCGTCCCCCCAGCTCCCAGCTGACCGTTTTTCCCCTGAGTTTGTGGACTTCACCGCACAGTGCCTAAGAAAGAACCCCGTGGAGCGCATGAGCTACCTGGAGCTGATGGAACATCCTTTCTTCACCTTGCACAAAACCAAGAAGACAGACATCACTGCTTTTGTGAAGGAAATCCTGGGAGAGGACTCATAGGGGGCAGGGCCTCGGACCCCACTCTGGCCCTCTAGTGCCCCACAGCCCCCTCTGCTGGAGCAGTGCTTGCCCACACCTATAAGCTACTGCCACCCTGGCCTTGGGCATTCCAAGAGGAATCGAGGGGGCTGCTCCCAAGTGCCAAAGAACCAGACTGTCGGGGCCCCCCGCTGGGCCCATGCGGGCCCCACCAGTGCCTCTGTCCTGCTGTTCCAAGTCTCCAGCCCTGAGGCCTTGGACTTGGAGGGGCCTGGATGCCCCTGCCAGACGCTGCTGCCCCTCACAGAAGGCATCCGGTGCTTGTGCACAGGCCACTGCCTTGGCCCAGCCCTGGATGCCACCTGAGTTGTATATTTTTGTATCTTTCGACTGAATGAACTTTGCACACTTCAAGGGTGGCCACACATCTCTCCCAGCATCAGTAGAGGGGACATGGGGATGAGCCACATGAGTCCTCCTGATCCCCCTCTGAGGGAGAAGCCAGAGCCACTTGAGGCCTTCACCCAGCACTGGCAAATGGCCTCTAAGGGGCACCAAGGACACTTAGCCTCTGCCTGCCACCTCTAGGGGTGTTGTTTCACTTTTTAAAAACAAATTTGTCTTTTTTTTTCTTTTGCTTTGTGGGTTTGGCTGGTTTTTCTCGCATGGTTTGGAGCCGATAACTTTTCTGCCACTCCCTAGGGGACCAGCAAGCTGAGACCCACCCTCTCCACTCAGGCTGGAGTCTAGGAGGATGAGCCCAAAGTCTCTGCTTAGAGAGGTATTCTTCTTGGGGATTGGCTTGACAGGGGCTATAGATTTGCTTTTGGTGTTAGAAAAGAAAAAAATGTTTTGAAGGACTACCTGTTCTGGGTTCTATCCCTGGTGGATTGGGGCAGTTACATGATTGCTGTTTTGATTT