Transcript asmbl_15224

Sequence
Transcript Sequence for observation asmbl_15224 of TGE0014815:
CGCCCCCCCGCCGCCCGCGCTTGGCCCGGCCCGGCAGCGAGAACGGCGCCATGGAGGCCACCGGGGTGCTGCCGTTCGTGCGCGGCGTGGATCTCAGTGGCAACGACTTCAAGGGAGGCTACTTCCCTGAGAATGTTAAAGCCATGACAAGTCTGCGATGGCTGAAAAAAATACCTGCCGGAGGAGTTGGCCTCCCTACAGAAGCTGGAGCACTTGTCTGTGAGCCACAACAACCTGACCACACTTCATGGAGAGCTGTCGAGCCTGCCATCACTTCGGGCCATCGTGGCTCGAGCCAACAGCCTGAAGAATTCTGGAGTCCCTGATGACATCTTCAAGCTGGATGATCTCTCAGTCCTGGACTTGAGCTACAACCAGCTGACAGAGTGCCCGCGGGAGCTGGAGAATGCCAAGAACATGCTGGTGTTGAACCTCAGTCACAACAGCATCGACACCATTCCCAACCAACTCTTCATCAACCTCACTGACCTGCTGTACCTGGACCTCAGCGAGAACTGCCTGGAAAGCTTGCCTCCACAGATGCGCCGCCTGGTGCACCTACAGACACTCGTGCTCAACGGGAACCCACTGTTACATGCACAGCTCCGGCAGCTCCCAGCTCTGACAGCCTTGCAGACCCTGCACCTGAGGAACACCCAGCGCACCCAGGGCAACCTCCCCACCAGCCTGGAGGGCCTGAGCAACCTTGCAGATGTGGACCTTTCCTGCAACGACCTGACACGGGTTCCTGAGTGCCTGTACACCCTCCACAGCCTGCGCCGCCTGAACCTCAGCAGCAACCAGATCACGGAGCTATCCCTGTGCATCGACCAGTGGGTGCATGTGGAGACCTTGAACCTGTCCCGCAATCAGCTCACCTCACTGCCTTCGGCCATTTGCAAGCTGACCAAGCTGAAGAAGCTATACCTGAACTCTAACAAACTGGACTTTGATGGGCTGCCCTCAGGCATTGGCAAGCTGGCCTGCTTGGAGGAGTTCATGGCTGCCAACAATAACCTGGAGCTGATTCCTGAAAGCCTCTGCAGGTGCACAAAGCTGAGGAAACTCGTCCTGAACAAAAACCGCCTGGTGACCCTCCCAGAGGCCATCCACTTCCTGACGGAGATAGAGGTCCTGGATGTGCGGGAGAACCCCAGCCTGGTCATGCCTCCCAAGCCTGCTGACCGCACTGCCGAGTGGTACAACATTGACTTCTCACTGCAGAACCAGCTACAGCTGGCAGGTGCCTCTCCTGCCACAGTGGCTGCGGCAGCAGCTGCAGGGGGTGGGCCCAAGGACCCCCTGGCTCGGAAGATGCGGCTACGGAGGCGCAAAGACTCAGCCCAGGATGACCAAGCCAAGCAGGTGCTGAAGGGCATGTCAGACGTGGCCCAGGAGAAGAATAAAAAGCAGGAGGAGAGTACTGACACCCGAGCCCCCGGGGGCAAGGTGCGGCGCTGGGACCAGGGCCTGGAGAAGCCTCGCCTCGACTACTCAGAGTTCTTCACAGAGGATGTGGGCCAACTGCCTGGCCTGACCATTTGGCAGATCGAGAACTTTGTGCCTGTGCTGGTGGAGGAAGCCTTACATGGCAAGTTCTATGAAGCTGACTGCTACATCGTGCTCAAGACCTTTCTGGATGACAGCGGCTCTCTGAACTGGGAGATCTACTACTGGATCGGTGGGGAGGCCACACTCGACAAGAAGGCTTGCTCTGCTATCCACGCGGTGAACCTGCGCAACTACCTGGGTGCGGAGTGCCGCACTGTGCGGGAAGAGATGGGAGATGAGAGCGAGGAGTTCTTGCAGGTGTTTGACAACGACATCGCCTACATCGAGGGTGGAACAGCCAGTGGCTTCTACACTGTGGAGGACACACACTATGTCACCAGGATGTACCGCGTGTATGGGAAAAAGAACATCAAACTGGAGCCTGTGCCACTCAAGGGGGCCTCTCTGGACCCGAGGTTTGTTTTCCTGCTGGACCAAGGGCTGGACATCTACGTGTGGCGGGGGACCCAGGCCACACTGAGTGGCACTACCAAGGCCAGGCTCTTTGCAGAAAAAATTAACAAAAACGAGCGGAAAGGGAAGGCAGAGATCACATTGCTGGTGCAAGGCCAAGAGCCCCCAGAGTTCTGGGGGGCACTGGGTGGTGAGCCCTCCGAGATCAAGAAGCATGTGCCTGATGATTTCTGGCCACCCCAGCCTAAGCTATATAAGGTGGGCCTGGGTCTGGGTTACCTGGAGCTGCCACAGATCAACTACAAGCTGTCTGTGGAACATAAGACGCGACCCAAGGTGGAACTGATGCCGGGGATGCGGCTGCTGCAGAGCCTACTGGACACGCGATGCGTGTACATCCTGGACTGTTGGTCTGATGTGTTCATCTGGCTTGGGCGCAAGTCGCCGCGCCTGGTGCGTGCTGCAGCCCTCAAGTTGGGCCAGGAGCTGTGCGGGATGCTACACCGGCCACGCCACGCCACGGTCAGCCGCAGCCTTGAGGGCACTGAGGCACAGGTGTTCAAAGCCAAGTTCAAAAATTGGGATGACGTGTTGACAGTGGACTACACGCGCAATGCAGAAGCCGTGCTGCAGGGCTCAGGACTCACCGGGAAGGTGAAGCGCGATGCCGAGAAGAAAGATCAGATGAAAGCTGACCTCACTGCGCTGTTCCTGCCCCGGCAGCCGCCCATGGCGCTAGCTGAGGCCGAGCAGCTGATGGAGGAGTGGAATGAGGACCTGGATGGCATGGAGGGCTTCGTGCTCGAGGGTAAGAAGTTCGCGCGGCTGCCTGAGGAAGAGTTTGGCCACTTCTACACACAGGACTGCTACGTCTTCCTCTGCAGGTGCCGTCTCAGCACACCTCCTTTGGCAGGCCCCTACCCTGGTGCTTGGGGGGCCCCTGCTTACTGCCCTCTGACCCTGTAGATACTGGGTCC