Transcript asmbl_14662

Sequence
Transcript Sequence for observation asmbl_14662 of TGE0014808:
GGGGCGGTCACGCTGCCTTCTCTCCCCACAGAGCCCAGGCCTCCTGGCCTCCCTGGGGGTGGGGCTGCTGACTCTGCTCGGCCTGGCTCTGGGCTCCTACTTGGTTCGGAGGTCCCGCCGGCCGCGGGTCACTCTTCTGGACCCCAATGAGAAGTACCTGCTGCGACTGCTGGACAAGACGACTCTGAGCCACAACACCACGAGGTTCCGCTTTGCCCTGCCCACCGCCCACCACGTTCTGGGGCTGCCTGTGGGGAGACACGTCTATCTCTCTGCCCGAATCGATGGCAGCCTGGTCATCAGGCCATACACTCCCGTCACCAGTGATGAGGACCAAGGCTACGTGGATCTCGTCGTCAAGGTGTATCTGAAGGGCGTGCACCCCAAATTTCCTGAGGGAGGGAAGATGTCTCAGTACCTGAACAGCCTGAAGATTGGGGATGTGGTGGAGTTTCGAGGCCCGAACGGGTTGCTCACTTACCTCGGGAAAGGGATTTTTAGCATTCAGCCCGACAAAAAGTCTCCAGCGGAGCCCCGTGTGGCCAAGAGCCTAGGGATGATTGCCGGTGGGACAGGAATCACCCCGATGCTTCAGCTGCTCCGGGCCATCCTGAAAGACCCTGAAGACCGAACTCAGTGCTGTTTGCTTTTCGCCAACCAGACTGAAAAGGACATCATCTTGCGTGAGGACCTGGAGGAGCTGCAGGCCCAACACCCCGGTCGCTTCAAGCTCTGGTTCACTCTGGATCACCCTCCAGAAGGTACCCTCTCCGTATTGGGTAACCAAAAATCAGGGCCTCGCGCCTGTGCCATTCTGGTTTCCGTGGAGCCAACCACACTCCCAAGTCTGAGTGCAGGGGCGCGGTGGTCCCCGGGCCCTCTCCCTCCGGTTCCTGTTTACCGGGGGGCGGCAGGA