Transcript asmbl_14193

Sequence
Transcript Sequence for observation asmbl_14193 of TGE0003736:
GACACGGAACGGCTGTATTCAGTGGTGTTCCAAGAAATCTGTGGGCGCTACGGGAAGACGTACAGCTGGGACGTCAAGTCCCTCGTCATGGGCAAGAAGGCCTTCGAGGCGGCCCAGGTCATCATAGACGTGCTGCAGCTGCCGATGTCCAAAGAGGAGCTGGTGGCAGAGAGCCAGGCCAGGCTCGAAGCGCTGTTCCCCACGGCGGGCCTCCTGCCAGGGGTGGAGAAGCTGATCCACCATCTGCGAAAGCATCGCGTGCCCTTTGCCGTGGCCACCAGCTCCGGGTCCGACACCTTCGTGATGAAGACCAGCGCGCACAAAGCGTTCTTCAGCCTCTTTCATCACGTCGTGCTGGGGGACGACCCCGAAGTGAAGAACGGCAAGCCGGACCCCGACATATTCCTCGCGTGTGCGAGGAGGTTCCTCCCCCCCGCCCCCGTGGACAAGTGCCTTGTCTTTGAAGACGCTCCCAACGGGGTGGAGGCGGCCCTCGCAGCCGGGATGCAGGTGGTCATGGTGCCCGATGCACACCTGCGCCGAGACCTGACGGCCAAGGCCACCGTGGTGCTGGAGTCCCTGCAGGACTTCCGGCCCGAGCTCTTCGGGCTGCCGCCCTACGAGTGAGCGGCGGCCACGCTGCTCCGCCTGCCCCGCACCCGCGTGTCACCATCGCCACGTCGCCCTCGTCCCAGCCTCACCCCTGTGCGCTGGCTCCAAAACGATGATAGGCTGTAGCCCCACGGTCGAGAGGAAACAAGGTAGAGACAGCGGGCAGGGTGCACTGAGCACAGCTGTCCCTTGCACAGTTAGAGTTGCCTACTGTATTAGTCTTAGCATAGTCAGAGTCACACACAGTGAGCACACGTGCACACACATCCATGCTTATGTGTGAACACGCACGCAGATATGTACGCGTGTGTATACATACGTGCATAGATATGTAAAATACAAGGAAAAATGAAATTACGTTTGTGTTCATTTCTTTTTAGTTTTTCTAAACCCTGACTAGAACATGTAAAAAATGCACACATATATTTATATGCTTTAGTCCGTGTGTGTGTGTGTACGTATACATATTTATAATTTATGTTCATTGTAAATATTTACAGTGTACATAAACACTGCAGAAATTGATACTCTTTTTTGCCTTCGAAATACCTCTCGACCATATCACCGGTGGTATTTTTAGTATGAACATAATTTTAGCCTGTATCTCATACCTAGGCACATACCCACATTCAAAAATGGTTTATAGCTCAAAAATTTATCCTCTCTCCTCTGAGAACATTTATTTTTCTAATATGTGCCTTGATGTATATGTAATTTGATTTCCGAATGTGTACTTGGTACAGCCCAGAGCCACAGCACATTTCCAGGATAATTCATCAGATGTTACACTTTGGCCATTAATCCCCTTTAATTGATTTACTCTGCCTTTTGTGAGTGACAGGCATTGAAATGGGACACATACAATCACAGGGGTGTGCCTGCTTCTGTACCCTTGCAGTTGGTCTCTGTCATTAATTGTCATTGAGCTAATTTTCAACTCTCAGTTGTAGAAAAAACATAGTAATGTATGTGATTGTCTGTTGGATGATTGCCTGTGAATGATCGCCTCTGGCTGGTGACCGATTGTACCTCAGTTCAGCAGCAAATTCATTTCACATTCTCGAAGGCCTGTGTACTTGTCTGTTCTTTGAATTCTCCTTCAACTGGCTGTAACATTTCACTGGTTAGCCCGCCAGTTAATTTACTTGAATAAAATTTTTGACAGCTGTTCACATTA