Transcript asmbl_13655

Sequence
Transcript Sequence for observation asmbl_13655 of TGE0014749:
GGCGGCCCAAGCGGTTTCAAACGGCTTAGAGCAGGCCCCTCGGTTCTGACCCGGCGGAGGAATTACTCTTAATTCTACGGAGAAACGAAGCACAATGGGAGATGACAGTGAGTGGATAAAACTGCCTGTTGATCAGAAATGTGAACACAAGCTGTGGAAAGCAAGATTAAATGGGTATGAAGAGGCCTTAAAGATCTTCCAGAAAATAAAGGATGAAAAGAGCCCAGAATGGTCCAAATTTTTAGGATTGATCAAAAAATTTGTAACTGATTCCAATGCAGTGGTTCAATTGAAAGGATTAGAAGCTGCACTTGTTTATGTCGAAAATGCCCATGTAGCAGGAAAAACCACAGGAGAAGTAGTGTCAGGTGTTGTAAGTAAAGTGTTCAACCAACCCAAAGCCAAAGCCAAGGAGCTAGGCATTGAGATTTGTCTGATGTACATAGAGATTGAAAAAGGAGAGGCTGTGCAAGAAGAGCTTCTAAAAGGCCTGGACAATAAGAACCCCAAGATCATAGTGGCCTGTATAGAGACACTGAGGAAAGCCTTAAGTGAATTTGGTTCCAAAATCATCTTGCTTAAGCCAATTATCAAAGTGTTGCCAAAACTCTTTGAGTCTCGAGAGAAGGCTGTTCGAGATGAAGCCAAACTAATTGCTGTGGAGATTTACAGATGGATTCGGGATGCTCTGAGACCCCCCTTACAAAATATAAACTCTGTCCAGTTGAAAGAACTAGAAGAAGAATGGGTCAAACTGCCAACAGGTGCTCCTAAACCAACTCGGTTTCTACGTTCCCAGCAAGAACTAGAAGCGAAATTGGAACAGCAACAGTCTGCTGGTGGAGATGCTGAGGGAGGTGGTGATGATGGTGACGAAGTGCCTCAGATAGATGCTTATGAGCTTTTGGAAGCAGTAGAAATTCTTTCCAAACTTCCCAAAGACTTTTATGACAAAATTGAGGCAAAAAAATGGCAAGAGAGAAAAGAAGCCCTGGAGGCTGTGGAAGTACTAGTGAAAAACCCCAAATTAGAAGCAGGCGATTATGCGGATTTAGTAAAAGCATTAAAGAAGGTAGTTGGAAAAGACACCAATGTCATGTTGGTGGCTTTGGCAGCAAAATGTCTTACTGGCCTGGCTGTTGGGCTAAGGAAGAAATTTGGACAATATGCAGGACACGTTGTGCCAACCATTTTGGAGAAATTCAAAGAGAAGAAGCCTCAAGTAGTACAAGCCCTGCAGGAGGCGATTGATGCAATCTTCCTTACTACCACACTACAGAACATCAGTGAGGATGTTTTAGCAGTAATGGATAACAAAAATCCAACCATCAAGCAACAGACATCTCTTTTTATTGCAAGAAGCTTCCGCCACTGCACTGCCTCTACCCTGCCAAAGAGCTTGCTAAAGCCCTTTTGTGCTGCTCTACTTAAGCACATCAATGATTCTGCTCCTGAAGTCAGAGATGCTGCATTTGAAGCATTGGGTACTGCTTTGAAGGTGGTTGGTGAGAAAGCAGTAAACCCATTCTTAGTTGATGTAGACAAACTCAAACTTGATAAGATCAAAGAATGTTCAGAAAAAGTAGAGCTGGTAAATGGTAAGAAAGTTGGACTGGCAGCCGAAAAGAAGGAATTCAAGCCTGTTCCTGGAAGGACTGCTGTTTCAGGGGCTGCAGGAGATAAGGACACAAAGGATATTTCAGCACCCAAACCAGGGCCCTTAAAAAAGGCACCTGCTTCTAAGGCTGGCGGGCCACCTAAGAAGGGGAAACCAACTGCACCAGGAGGCACAGGGAGTGCCGGAACCAAGAACAAGAAAGGATTGGAGACCAAAGAAATAGTGGAGCCTGAGCTCTCGATAGAAGTATGTGAAGAAAAAGCTTCAGCTGTCCTGCCTGCTACCTGTATACAGCTTCTAGACAGCAGTAACTGGAAGGAAAGGCTGGCCTGTATGGAAGAGTTCCAAAAGGCTGTTGAACTAATGGACCGAACTGAAATGCCATGCCAGGCATTAGTGAGAATGCTGGCCAAGAAACCTGGATGGAAGGAAACTAATTTTCAGGTGATGCAGATGAAGCTTCACATAGTTGCTTTGATTGCCCAGAAGGGAAATTTTTCAAAAACTTCCGCTCAGATTGTCTTGGATGGCCTTGTAGACAAGATTGGAGATGTGAAATGTGGGAACAATGCAAAAGAAGCTATGACAGCAATAGCCGAAGCTTGTATGTTGCCATGGACAGCTGAGCAGGTTATGTCAATGGCCTTCTCACAAAAGAATCCCAAGAATCAATCAGAAACTCTGAACTGGCTGTCAAATGCAATAAAAGAATTTGGTTTTTCTGGATTGAATGTGAAAGCTTTCATTAGCAATGTGAAGACAGCTCTCGCTGCGACAAACCCAGCTGTGAGGACTTCTGCCATCACCCTGCTTGGTGTGATGTACCTGTATGTTGGTCCCTCTTTGCGAATGTTCTTTGAGGACGAGAAGCCTGCCCTCCTATCCCAAATAGATGCAGAATTTGAGAAGATGCAGGGACAAAGCCCACCCGCTCCAACCAGAGGGATTTCCAAACACACCACAAGTGGTACAGATGAAGGAGAAGAAGGAGATGAGCCAGATGATGGGGGCAATGATGTTGTAGATCTTTTACCAAGGACAGAAATCAGTGATAAAATCACTTCAGAGCTGGTGTCTAAGATTGGTGACAAAAATTGGAAGATCAGGAAAGAAGGCCTAGATGAAGTGGCAGGTATTATCAATGAAGCAAAATTTATCCAACCAAATATAGGTGAACTTCCAACTGCCTTGAAGGGTCGACTCAATGATTCAAATAAAATCTTGGTGCAGCAGACGTTGAATATCCTCCAGCAGTTGGCAGTAGCCATGGGCCCAAACATCAAGCAACATGTGAAGAACTTAGGCATCCCTATCATCACAGTCCTTGGAGACAGCAAGAACAATGTTCGAGCTGCTGCCTTAGCGACTGTGAATGCTTGGGCAGAACAGACAGGCATGAAGGAATGGCTGGAGGGAGAAGATCTTTCTGAAGAGCTCAAAAAGGAAAATCCTTTCCTGAGGCAAGAGCTTCTGGGCTGGTTGGCTGAGAAACTACCAACTCTTCGTTCCACCCCCACAGACCTTATCCTGTGTGTTCCCCATCTCTACTCCTGCCTAGAGGATCGCAATGGAGATGTGCGAAAGAAGGCCCAAGATGCCTTGCCATTCTTCATGATGCATTTAGGATATGAGAAAATGGCTAAAGCTACGGGGAAACTAAAGCCAACTTCTAAAGATCAGGTATTGGCCATGCTAGAGAAAGCCAAAGCTAACATGCCAGCCAAGCCCGCTGCACCTGCTAAAGCAACTTCCAAACCAGTGGGAGGGTCAGCTCCAGCCAAATTCCAGGCTGCCTCAGCACCTGTTGAAGATTCTGTTTCCAGCACTGTAGAACCCAAGCCTGATCTGAAAAAGGCCAAAACTGTAGGAGTTTCCTCTAAAGCAAAGAGTGCACAAGGAAAGAAAGTGCCGAGCAAAACCAGCTTAAAAGAGGATGAAGATAAATCTGGTCCTATTTTTATTGTTGTTCCAAATGGAAAGGAGCAAAGAATGAAAGATGAAAAGGGATTAAAGGTGCTGAAGTGGAATTTTACTACTCCACGAGATGAATACATTGAGCAACTAAAGACTCAGATGTCTAGCTGTGTGGCTAAATGGTTACAGGATGAGATGTTTCACTCAGACTTTCAGCATCATAACAAAGCCCTTGCTGTCATGGTCGATCACTTGGAGAGCGAAAAAGAGGGTGTCATTGGTTGCCTGGATCTTATCTTGAAGTGGCTTACCCTGCGGTTTTTTGACACCAATACAAGCGTCCTAATGAAGGCTCTAGAATATTTAAAATTACTCTTCACCCTGCTAAGTGAGGAGGAGTATCATCTTACTGAGAATGAAGCATCTTCCTTCATCCCCTATCTCATCCTCAAGGTTGGAGAACCAAAGGATGTCATTCGTAAAGATGTCCGTGCCATCCTGAACCGGATGTGCCTTGTCTACCCAGCCAGCAAGATGTTCCCCTTCATCATGGAAGGAACCAAATCCAAAAACTCAAAGCAGAGAGCAGAGTGCCTGGAAGAACTGGGGTGCCTGGTCGAGTCCTATGGCATGAATGTTTGCCAACCAACTCCAGGAAAAGCCTTAAAGGAGATAGCAATTCACATAGGAGACCGTGACAACGCTGTGCGCAATGCTGCCCTCAACACCATCGTCACAGTATACAATGTACATGGGGATCAGGTGTTCAAACTTATTGGAACTCTTTCTGAAAAGGATATGAGCATGCTCGAGGAAAGGATTAAGCGATCAGCAAAGAGGCCTTCTGCTGCACCAATAAAACAGGTGGATGAGAAACCTCAGCGCACACAGAGCATAAACTCCAATGCCAACATGCTACGCAAGGGACCAGCTGAGGACATATCCTCCAAACTCAACCAAGCTCGAAACATGAGTGGGCATCCGGAGGCAGCCCAGATGGTGCGCCGAGAATTCCAGCTGGATCTAGATGAGATTGAGAATGACAATGGTACAGTCCGATGTGAAATGCCAGAACTTGTTCAACACAAACTGGATGACATTTTTGAAC