Transcript asmbl_13542

Sequence
Transcript Sequence for observation asmbl_13542 of TGE0014739:
CGGATCTGTGAATAAGCACACGAAACAAACAGAGCTTTCGTCACCGAGGGCAGACGGTTTGCTGCAACGGCACGAGGGTATTCGTGCAGAAGGAAATTCTCGACAGATTTACCGCAGAAGTGGTGAAACAGACCAAAAGGATAAAACTCGGGGACCCCCTTCTAGAGGACACCAGGATGGGCCCCCTCATCAACCGGCCACACCTGGAGCGTGTCCTTGGGTTCGTCAAACTGGCAAAGGAGCAGGGCGCTACAGTGTTATGTGGTGGAGAGCCCTACGTGCCCGAGGACCCCAAGTTAAAGGACGGGTTCTACATGACGCCTTGCGTGTTAACTCATTGCAGGGACGACATGACCTGTGTGAAAGAAGAGATCTTTGGACCAGTTATGTCCATTTTATCATTCGACACCGAGGCTGAGGTTCTGGAAAGAGCCAACGATACCACGTTTGGACTGGCCGCTGGCGTCTTCACCAGGGACATCCAGCGTGCTCACAGAGTGGTCGCCGAGCTCCAGGCCGGAATGTGCTTCATCAACAACTACAGCACCTCCCCCGTGGAGCTGCCCTTTGGAGGGTATAAGAAGTCAGGGTTTGGCAGAGAGAACGGCCGTGTGACCATCGAGTATTACTCACAGCTAAAGACTGTGTACGTGGAGATGGGCGATGTGGAGTCTGTGTTTTGAAATCGCGCCGTGAAACCCGTCGACGTGGCCAGGCCGAGGAACAGAGAGGACCGGCCCTCTCGGCGGGCCCGGCCTTCCCCATCCCCCACCCCCCTGCACCCCGCTTCCGTCACTGGGGACAGGATTCGTCACCCAGACATCTTCCTAACTGAAACTGTAGAAGTGCCTTCTCCTCTGCTGTTACGGTTTCCTTTGGAGGGTTGAGCAGCAGCAGGTGCTCTTCTCTGCCTCCCCGTCCAATCTTGTCTCCCAGAGGTAACTACTGTTAACACTTGGGTACTGGTTTTTCTAGGATTTTCTTCAAGGGGATAACTGCTAACGAACCCTTTATCTGGACGGGGCCTCGTGTAAGTGGGCCCACCTCACACCATTCTTATGTATTTTAAGATGTCCTTGGTTGGCAGATGCCTACGCTACAGGTATTGATAGACGTCTTGGAATGGTATTAAAGCGAGCGAGAAAAAGCAAACCGCCCCCTGCTGGCTCCTTCCGTTGCAACAGCACAGAGACCTGATCCGACCTGGCTTGTTGTCACCTCCCATTCAGAGGCAGGTCTCGCCTGGGCAGGTCTTGCGCATACGGAAGGTACCACCGGGCCCCTTCCTTCCGCCTACTGCCTTTCGTTTCGTTTCGTGCTCTGTAGGTAGGTCCTCTTGCTGCTTAAGGCCAGGCTCCGGTTGGCTGAAGTTGGCTGACCGTCCGCCTCTTGCAGAGGGGCGAGAGCACCCCCGAGCCCCGCCCGCTTCTTACAATGCAGAGTCCACTCAGCCTCTCTG