Transcript asmbl_13485

Sequence
Transcript Sequence for observation asmbl_13485 of TGE0003685:
GTGAACCTGAGGAAGGAGCGGGGCCAGCGCGCAGGCCCGGAACCGCCGGAGCCGGGGCTGCCGGCGACGCCCCAGAGCGGAAGAGGGAAGTGAAGGCACCAGGCTGCGGGTTCCTGTCTGACTGGGCTTGCTAAGGTAGAGGCAGCACGGAGAAGAGGCCTTTGCCACCGCTCCGGATCGGAGATGTCGAAGAACACGGTGTCGTCGGCCCGGTTCCGGAAGGTGGACGTAGATGAGTACGACGAGAACAAGTTCGTGGACGAAGAAGACGGGGGCGACGGACAGGCGGGGCCCGACGAGGGCGAGGTGGACTCCTGCCTGCGGCAAGGAAACATGACAGCTGCCCTGCAGGCAGCTCTGAAAAACCCCCCTATCAACACCAAGAGTCAGGCTGTGAAGGACCGGGCAGGCAGCATTGTCCTGAAAGTGCTCATCTCTTTTAAAGCTAATGATATTGAAAAGGCAGTTCAATCCCTGGACAAGAATGGTGTGGATCTCCTAATGAAGTATATTTACAAAGGCTTTGAGAGCCCCTCTGACAATAGCAGTGCTGTGTTATTGCAATGGCATGAAAAGGCACTTGCTGCTGGAGGAGTGGGGTCCATCGTTCGAGTGTTGACTGCCAGAAAAACCGTGTAATCCAGCAGGAGCTGGATGTCTCCTGTGGGTGTGGGAATTGCTGGTACAAAGACCAAAACAACCAAATGCCACAGCTGCCCTTTGGGTAGCATCTATTTCTCTCAGCTTTGCCTTCTTGCTTCCTCTTTCATATCTATAAAGAAGAAAATTACATATCAGTTTTCCTTTAATGAAAATTGGGATGACATAGAGGGAATGTTTCAACAGAAGTGTTTCATGCTCTCAAAACTATTTCAGTGATGTGTATACCAATCTGTATATAGTATAATTTACATTCACGTTTAATTGTGTAATTTCTAACCCCTTAATTGGCTGGCATTTTTTGTTTTTCTGTTTTTTGTTTTTGGTTTTTTAGTTTTGTTTTTAACTAATAGTGATCTAAATTGGATGCTGGTTTCCTAACTCGTTGCTAGCCAGGAAATGACTCTTATAAAAAATATTTTTCAGAGACTGGCAGCTATTAACATTGCAAAACTGGACCATACTTCCTTTATTTAAGCAAAATGTGTTTCTGGGACAAGTGGTGGGTGAGCACCACTACCGCGTTCCAGTTTTGTTTCTGCTTGCCTCCAGATCATGTGAGTTTAAGTATGCTTCTTCCTCTCAGCATCCAATAATCATGGCCTCTCGATTTCTTTGGTCACCAGGGTCCAGAGCAAGGAGTCTTGCTCTATGCAGATGTATCTATAAAATACCAGAGCCTTTTTGGCATGAGCATAAAACTTTGTTTCAATTATGTGGCCCTATTTGGAGAAACTACTCCAAATCAGAAAGGACATGGAAACTATGATGTAGTTCAAACTCTGGGCGGCCTCCGAATGAAATGATACTTCCCATAGAGCTATAGTAGCTGCCTTAGACATTATGAGGTATATAACCAGTATTTAATATGCCCTATAAATGTCTTCAGTGTTCTTCAGGGTAATTGGGATCTCAAAAGATTTGGTTCAGATCCAAACACGCACACATTCTGTATTTTAGCTCAGTGGTTT