Transcript asmbl_13415

Sequence
Transcript Sequence for observation asmbl_13415 of TGE0003680:
CTTATTTGTCACTTGGTGACTGGTGTGTGCGGGGTCTGGTAGCCGCACTCTAGAAGGTTATTGCTCGCTGGCCCTCAGGTGTCCCGCTGATATCCCGGAAAATGACGGCTTCTTACGGCACGCGAACGACACCTCCCCGCTGCCACAAGAACCTTTTTCATTCTTGCCGCTTCGTTGGGATCTTTTTGATGACTCTAGTTATCCTGTTACCGACATCCTCCGATGCTTGTGATGATCCACCGAGATACGAATCTATGATGCTCAAGGATGTTTCTAAAGACTTGTATCTTCCTGGGGACCAAATAGAATTTAAGTGTCGCCTAGGATTCAAGCCTATTATACCTCTTCTTCCCACCACTGCTATTTGTCAGTCTGATAACACATGGACACCTCTCCAGGAGGCTTGTACAAGAAAATCATGTCCACAACTAGCAGACCCTTCAAATGGTCAAGTAAATGGAACTTTTCTGTTTGGTTCAGAGGTTCACTTTGTTTGTAATGAGGGTTATGAATTAGTTGGAACAAAAATTCTATATTGTGAAATTTCTGAAAATAATGTGGCTTGGAGTGGTGATCCCCCACAGTGTGAAAAGATTATGTGTCAACCACCTGGAGACATACCAAATGGAAAACATACCAGTAGCCACAAGGATGTATTTGAATATAATGAAGTAGTAATTTACAGCTGCAATCCTTCAGGAGGACCAGACGAATATTCACTTGTTGGAGAGAGCAGACTAGTTTGTTCTGGGAGAGACACATGGAGTAGTGCCCTTCCTGAGTGTAAAGTGGTCAAATGTCAATTTCCAGTAGTCAAAAATGGAAGACTGATAGCAGGATTTGCAAGAAAATTTTACTACAACGCGCAGGTTGTATTTGAATGCGTCCAGGGTTTTCACCTTAAAGGCAACAGCACAATTGTCTGTGGCGCTAACAATGAATGGCAGCCTAAGATGCCAGAATGTATTGAAGGTCTCAAGCCTACTAGTCCAGCCACATCTCCAGTTCCAAGACCCACAGATTCAGAACATGCCACTCCCGGTGATGAACCACCTAAATATTTAGGTGGAGGAATCATTGCTTTGATTGTTATTGTTACAGTTGTTGGCATTGCACTAATTTGCTGCATCGTGTGGATAGTTTTGCACAAAAAGAAGAAAAGGTTGCAGGAAAACCGTTGGGGTTAAAATTAAAGTTGCTGAGAGGGG