Transcript asmbl_12834

Sequence
Transcript Sequence for observation asmbl_12834 of TGE0003675:
CCAGTCTGTGGGGGGTTTTTACTGATAGGTGCCATATTCAGGACAGAGCAATTCATTTCTATTCTGTTCTCCCCGTTGTACCCACAAGCAGGTGACAAGTTCGTCTTCGCTACTAGACGATAAAGACAGCATTCAAGGAAGTCGTAAGGCAGCACGACTCCCCATCTTCCCATAGTAAAGATGGAGGCGCCCTGCATGTAAACGACAGGTAAAACTACTTCCGCCTTTCTCCTGCGCCCTCGTCCAAGATGGCGGACGAGGCCACCCGGCGTGTCGTGTCTGAGATCCCGGTGCTGAAGACTAACGCCGGACCTCGAGATCGGGAGTTGTGGGTGCAGCGACTCAAGGAGGAATACCAGGCTCTTATCCGGTATGTGGAGAACAACAAGAATGCGGACAATGATTGGTTCCGACTGGAGTCCAACAAGGAAGGGACTCGGTGGTTTGGAAAATGCTGGTACATCCACGATCTCCTCAAATATGAGTTCGACATCGAGTTTGACATTCCTATCACATATCCTACTACTGCTCCAGAAATTGCAGTCCCTGAGCTGGATGGAAAAACAGCAAAGATGTACAGGGGTGGCAAAATATGTCTGACCGATCATTTTAAGCCTTTGTGGGCCAGGAACGTGCCCAAGTTTGGATTAGCTCATCTTATGGCTCTGGGGCTGGGTCCATGGCTGGCAGTGGAAATCCCCGATCTAATTCAGAAAGGCGTGATTCAGCATAAAGAGAAATGCAGCCAATGAAGGATCAAGCCGCTGAGGCTGAGACTTGGATAGGCTACGTTCCTGTTTTCCTGTGCATCCCTCTTCTTACTCATCCGACCGCTTCACTCACACCCCTTCGCCTACAGCGGTTACTAAGTAGCTGCAGCGGTACAGTTTCCAGCATTGCCGGGGTGAAAAAACAGTGTTGCTACTGAGTTTCTAAGTTAGGCTGTACAGGGAGGGGAGAGGCTGGGGCTTTGGAAAAACCGAAAGGTAATTTATACCCCTTCCCCAGGCGGAGCGGTGTGAGATCCTGGAAGGACAGGGGATGGTTGAAAGTGGGTACACAGTCTTTTTGGTTTCCGGAAATAACTCATCAATAAAAGCTGCTTCTTC