Transcript asmbl_12825

Sequence
Transcript Sequence for observation asmbl_12825 of TGE0003671:
CGCGTGCTGATAGCACGGGTGCGGCCCTTATCAGCCAGCACCGGCTCCTCCCTCGCTTTCTCTCGGCCCCCTCCTGGGTGGGCCCTGCGCCCCGGGTGCCCCGAAAGCAGTCAGCGGCCGGGGCTGGAGCGCGCATCCCGCGCAGCTTCCGGAGAGAGGGATCCCCTGGCCAGCCTGTCCGCGTCGCCGCTCTCCCCCAGGTCCCAATGGGCCGGACCGTGGTCGTGCTGGGCGGAGGCATCAGCGGCTTGGCCGCCAGTTACTACCTGAGCCGGGCCCCCTGTCCCCCCAAGGTGGTCCTGGTGGAGGGCAGCGAGCATCTGGGAGGCTGGATCCGCTCCTTGCGCGGCCCAGACGGCGCTGTCTTTGAACTTGGACCTCGAGGAATTCGGCCAGCAGGAGCGCTGGGCGCTCGGACCCTGCTCCTGGTGTCTGAGCTCGGCCTGGACTCCGAAGTGCTGCCCGTCCGGGGGGACCACCCTGCGGCCCGGAACCGGTTCCTGTACGTGGGCGGCGCCCTGCACGCGCTGCCCTCCGGCTTCAGGGGGCTACTCCGCCCTGTGCCTCCCTTCTCCAAACCTCTGTTTTGGGCTGGGCTGAAGGAGCTGACTGCACCCCGGGGCAAAGACCCTGACGAGACTGTGCACAGTTTTGCTGAGCGCCGCCTTGGACCTGAGGTGGCGTCTCTCGCCATGGACAGCCTCTGCCGTGGAGTATTTGCAGGCGACAGCCGGGAGCTCAGCATCCGCTCTTGCTTTCCCAGTCTCTTCCAGGCGGAGCAAAGCCATGGCTCCGTGTTACTGGGGCTGCTGCTGGGGGCAGGGCGGAGCCCACAGCCCGACTCAGCCATCATTCGCCAGGCCAGAGCTGAGCGCTGGAGCCAGTGGTCACTCCGTGGAGGACTGGAGAGGTTGCCTCAGGCACTTCACAGCCACCTGACTCGTAGGGGGATCAGTGTTCTCAGAGGCCAGCCAGTCTGTGGGCTCAGCCTCCAGGCAGGAGGGCACTGGAAGGTGTCTCTAGCGGACTGCAGCCTGGAGGCTGACCATGTCGTCAGTGCTATTCCAGCTTCAGCGCTCGGCGCGCTGCTGCCTGCCGAGGCCTCACCACTGGCCGAAGTCCTGAGAACCATCCGAGCGGTGTCTGTGGCTGTGGTGAATCTGCAGTACCGCGGAGCTCGTCTGCCTGTCCAGGTGACACCGCGGAAGGGGAGACGCGGGCTCAAGTTCACGCCTCCCGGCTGAACCCATCCCTTCCTTTTGTCCAGGGGTTTGGACACTTGGTGCCGTCCTCGGAAGACCCAGGCGTCCTGGGGATCGTCTACGACTCAGTTGCTTTCCCTGAGCAGGATGGCAGCGCCCCCAGCCTCAGAGTGACTGTGATGCTGGGAGGTTCCTGGTTACAGACGCTCGAACCCGGAGGCTCCGGCCTATCCCGGGACCTGCTCCAACGCCAGGCACAGGAAGCAGCTGCCACACAATTAGGACTGAAGGGGCCACCAAGTCATTGCTTGGTTCATCTACACAGGAACTGCATCCCCCAGTATACACTAGGCCACTGGAAAAAACTGGAGTCAGCCACCCAGTTCCTGGCTGCTCACAGACTGCCCCTGACTCTGGCCGGAGCTTCCTATTGGGGGGTCGCTGTCAATGACTGTATAGAGAGTGGACGCCAGGCAGCAGCCCAGGTCCTGGGCTCAGCACCCCATAGCTGATCCCCACTCCCAGCACCTGCCTGCTGGCGGGGAGTCTCTCACCCATGACAATAAAAGTTGCTGGAGGTTG