Transcript asmbl_12823

Sequence
Transcript Sequence for observation asmbl_12823 of TGE0003671:
CGCGTGCTGATAGCACGGGTGCGGCCCTTATCAGCCAGCACCGGCTCCTCCCTCGCTTTCTCTCGGCCCCCTCCTGGGTGGGCCCTGCGCCCCGGGTGCCCCGAAAGCAGTCAGCGGCCGGGGCTGGAGCGCGCATCCCGCGCAGCTTCCGGAGAGAGGGATCCCCTGGCCAGCCTGTCCGCGTCGCCGCTCTCCCCCAGGTCCCAATGGGCCGGACCGTGGTCGTGCTGGGCGGAGGCATCAGCGGCTTGGCCGCCAGTTACTACCTGAGCCGGGCCCCCTGTCCCCCCAAGGTGGTCCTGGTGGAGGGCAGCGAGCATCTGGGAGGCTGGATCCGCTCCTTGCGCGGCCCAGACGGCGCTGTCTTTGAACTTGGACCTCGAGGAATTCGGCCAGCAGGAGCGCTGGGCGCTCGGACCCTGCTCCTGGTGTCTGAGCTCGGCCTGGACTCCGAAGTGCTGCCCGTCCGGGGGGACCACCCTGCGGCCCGGAACCGGTTCCTGTACGTGGGCGGCGCCCTGCACGCGCTGCCCTCCGGCTTCAGGGGGCTACTCCGCCCTGTGCCTCCCTTCTCCAAACCTCTGTTTTGGGCTGGGCTGAAGGAGCTGACTGCACCCCGGGGCAAAGACCCTGACGAGACTGTGCACAGTTTTGCTGAGCGCCGCCTTGGACCTGAGGTGGCGTCTCTCGCCATGGACAGCCTCTGCCGTGGAGTATTTGCAGGCGACAGCCGGGAGCTCAGCATCCGCTCTTGCTTTCCCAGTCTCTTCCAGGCGGAGCAAAGCCATGGCTCCGTGTTACTGGGGCTGCTGCTGGGGGCAGGGCGGAGCCCACAGCCCGACTCAGCCATCATTCGCCAGGCCAGAGCTGAGCGCTGGAGCCAGTGGTCACTCCGTGGAGGACTGGAGAGGTTGCCTCAGGCACTTCACAGCCACCTGACTCGTAGGGGGATCAGTGTTCTCAGAGGCCAGCCAGTCTGTGGGCTCAGCCTCCAGGCAGGAGGGCACTGGAAGGTGTCTCTAGCGGACTGCAGCCTGGAGGCTGACCATGTCGTCAGTGCTATTCCAGCTTCAGGTAATGGGCTCGCCACCCCCACCTTCCCCAGCCAGGGCGAGGCATGCTGGAGGCACTGGACCAGCAGGACCGTCCCCTGCCCCTGAGCTGGTCCCCTGCAGGAGGCTAGTGTCGGGAAGGGCTGGTGACTAGCCTGCCTCTGCCTGCTCCCCCAGCGCTCGGCGCGCTGCTGCCTGCCGAGGCCTCACCACTGGCCGAAGTCCTGAGAACCATCCGAGCGGTGTCTGTGGCTGTGGTGAATCTGCAGTACCGCGGAGCTCGTCTGCCTGTCCAGGGGTTTGGACACTTGGTGCCGTCCTCGGAAGACCCAGGCGTCCTGGGGATCGTCTACGACTCAGTTGCTTTCCCTGAGCAGGATGGCAGCGCCCCCAGCCTCAGAGTGACTGTGATGCTGGGAGGTTCCTGGTTACAGACGCTCGAACCCGGAGGCTCCGGCCTATCCCGGGACCTGCTCCAACGCCAGGCACAGGAAGCAGCTGCCACACAATTAGGACTGAAGGGGCCACCAAGTCATTGCTTGGTTCATCTACACAGGAACTGCATCCCCCAGTATACACTAGGCCACTGGAAAAAACTGGAGTCAGCCACCCAGTTCCTGGCTGCTCACAGACTGCCCCTGACTCTGGCCGGAGCTTCCTATTGGGGGGTCGCTGTCAATGACTGTATAGAGAGTGGACGCCAGGCAGCAGCCCAGGTCCTGGGCTCAGCACCCCATAGCTGATCCCCACTCCCAGCACCTGCCTGCTGGCGGGGAGTCTCTCACCCATGACAATAAAAGTTGCTGGAGGTTG