Transcript asmbl_12745

Sequence
Transcript Sequence for observation asmbl_12745 of TGE0014718:
CTAGCCGCCATCTTGCTTCTTTTTCTCGCTCGCTCTCTCTCCCTGCTCGGGAAGAAGCGAAAGTGCTTTGGCGGTTTGTCCATCTGCAGCTGCGGCTCCCCCAGCCCGGTGGTCCTGCGGCCACCGCTGGCCCCAGCCTCCTCTCGCCCTTCCTTGGATCAGAGCTCGGCCGAAGCCCTCGAAGTGCGCACACACACTCAGCTTGACACCCTGGCCGACTGGTTTTAAGGGGTGTGGCAGGAGGTTTTGGACTCGATGAGTTTCCACCGAAATGTCGGAGAAGTCAGGCCAGAGCACAAAAGCAAAGGATGGGAAAAAGTATGCGACACTCAGTTTATTTAATACTTACAAGGGGAAGTCATTAGAAACTCAGAAAACCACAGTTGCAGCTCGACATGGATTACAGAGTCTTGGAAAAGTTGGAATTTCACGGCGGATGCCTCCCCCTGCTAACCTTCCAAGTCTCAAAGCAGAAAACAAAGGCAATGACCCTAATGTGAACATCGTACCGAAAGACGGCACAGGGTGGGCGTCAAAGCCAGAGCAGCATGAGGAAGAAAAAACACCAGAAGTTCCACCAGCACAGCCAAAACCTGGGGTTGCAGCTCCCCCAGAAGTAGCACCTGCTCCCAAATCATGGGCCAGTAACAAGCAAGGAATCCAGGTGAACAGTCATTTTCAGCAAGAATTTCCGAGCTTGCAGGCAGCTGGGGATCAGGAAAAAAAAGAAAAAGAAGCAACCGATGACAACTATGGACCTGGACCTAGTTTACGCCCACCAAATGTTGCTTGTTGGAGAGATGGCGGTAAGTCTGCTGGCCCACCCTTAACCTCTGACCAAGATGAAAAGCTCCCTGGCCAGGATGAAAGCACAGCTGGATCATCAGAGCAAAATGACATCCTCAAGGTGGTGGAAAAGAGGATAGCTTGTGGTCCTCCGCAAGCTAAACTCAATGGACAGCAGCCTGCCCTCACTTCCCAGTACAGAGCCATGATGCCTCCCTATATGTTTCAGCAGTATCCAAGGATGGCGTATCCTCCTCTTCATGGTCCCATGAGGTTTCCACCTTCTTTATCTGAAGCAAACAAAGGTCTTCGAGGAAGAGGCCCGCCTCCTTCGTGGGCCTCTGAGCCTGAACGCCCCTCCATCCTTAGTGCATCAGAGCTGAAGGAGCTCGATAAATTTGATAACCTAGATGCTGAAGCTGATGAAGGTTGGGCAGGTGCCCAGATGGAAGTAGATTATACAGAACAGCTGAATTTCAGCGATGATGATGAGCAAGGAAGTAGTAGTCCTAAAGAAAACAGCAGTGAGGACCAAGGTTCAAAAGCCTCTGAAAACAGTGAAACCCGAAAAGAAGCAGATGAAGTGTGCAATACTAAATCGTCATCTCAGATACCTGCCCAGCCACCAGTAGCAAAAGGTCCCTATGGGAAAGGACCACCATTTAATCAGGAACGTGGACCATCTTCCCACCTGCCACCACCTCCAAAGCTGCTTGCACAGCAGCATCCTCCTCCAGACCGACAGGCAGTACCTGGAAGACCAGGCCCTTTCCCCGCCAAGCAGCAAGTACCTGACGAAGATGAAATATGGAAGCAGAGAAGAAGACAGCAGTCAGAACTTTCTGCAGCGGTGGAACGTGCTCGTAAACGGCGTGAAGAGGAAGAGCGAAGGATGGAAGAACAGAGGAAGGCAGCTTGTGCTGAGAAATTGAAACAGTTGGATGAAAAGCTTGGTATCGTGGACAAGCAGCCATCTCCGGAGGAAATCAGAGAAAGGGAGCGGGAAAAGGAACGGGAGCGGGAGAAAGAACTCGAAAAAGAACAAGAACGGGAGCGAGAGAAGGAGAGGGAAAAAGAAAGGGAGAGGCTGCAGGAGAAGGAGAAAGAGCTGGAGAGAGAGCAGGAGAAACAAAGAGAAATGGAGAAGGAAAGAAAGCAAGAAAAAGACAAAGAACTAGAACAGCAGCCGGAAAAGGAAAAAGAACTAGAACTGCAAAAGACGAAAGAACAGGAAAAGGAGGGTGAATCGGAGAAGAAAGAAAGGGAGAAAGTGGAGGAAAAAATCGAGCACAAGGAACCTGCTTTAGAGCCTCTGGTAGAAAAACCAGAAAGTGAAAGCAGCACTAATAAAGAGGGTGACCCCGTTTTCACTAGACAAGACAGCAGTCGCGGTGAGAAAGAGACCACACAAGTGGCACACGAAACGGAACCAGAGTCAGGGTCTCAACCTCGGCCTGCTGTTTTATCTGGGTATTTTAAACAGTTCCAGAAGTCCTTACCACCACGGTTCCAGCGGCAGCAGGAGCAGATGAAACAGCAGCAATGGCAGCAGCAGCAACAGCAAGGTGTACTTCCACCGACGGTCCCATCGCAGCCATCCAGTGGCGCTGTCCCTCCTCCCCCACACAGGCCTCTTTACCAGCCAATGCAGCCCCACCCTCAGCACTTGGCATCCATGGGTTTTGATCCAAGGTGGCTCATGATGCAGTCGTACATGGATCCAAGAATGATGTCAGGTAGAGCGGCCGTGGACATCCCTCCCATTCATCACGGAATGATTCCTCCTAAACCACTGATGAGAAGAGATCAGATAGAAGGGTCACCAAACAGTTCTGAGTCATTTGAGCATATAGCTCGATCTGCAAGAGACCATGCAGTGCCCCTCTCAGAGCCGCGTCTGATGTGGGGGTCAGATCCCTACCCTCATCCTGAGCCTCCACAGGCCGCCACTCCCCAGGCAGCGGAAGAGCCTGAGGGCGTAAGGCCCGAAGCTCCGTTGGCTCAGGAACAGGTTACTGCTGCTTATCCTGTAGAACACAGTCGGCCAGAGCCTCGTCCCAAAGCGGACTTTGCTAGAGAGCCAAGTGAGACGGAAGTACAGAAGTTTTTAAGCAGGTCTGTGGAAGACATTAGACCTCACCCCACGGACTCAAGCAGTCAGCCTGCTTGTTTTGACGTCCTTGATCAAAAGACTGCAACTGCCCCTCACGAAGAGCGGCCTGCAGCTGGGGAAAGTCAGCCTGCCCGGAAAAGGAGTGTTTCCCACGGGTCTAACCACCCGCAGAAATCAGAGGAGCAGAGAAGCGAGCCGCCTGCCAGCATTCCTAAGGTACCCAGCAGGTGCATAGAACCGAAAGAACCCGCAGACAGGTCGGAGGACAAACCAAAAAAGGACGGCTTCATACGGTCTTCCGAAGGACCGAAACCTGAAAAACTGTATAAATCCAAGTCGGAAACTCGCTGGGGCCCACGGCCAGGTTCCAACAGAAGAGAAGAAGGTAGCGATCGGCCTGTGAGAAGATCGGGTCCCATTAAAAAACCTATACTTAGGGATATGAAAGAGGAGCGAGAGCAAAGGAAGGAGAAAGAAGGAGAAAAGGGAGAAAAGGCCACTGAGAAAGTTGTAAAAGCGGAAAAAACGGAAAAGAAAGATCCTGTCCCTGCGCC