Transcript asmbl_12743

Sequence
Transcript Sequence for observation asmbl_12743 of TGE0014717:
CTCACCCTCCACGCCACTACCAACGTCAGCCTCGGTGCCAGTGCCAGCTTCCACCTCAGCTACCACCCCCTCTTCTTCAGTTCCAGCTCCAACCCCCATCCTTGCCTCAGCTTCGACCCCAGCCTCTGTCCCCATCCTGACCTCAGCCTCAATTCCCATCCTTGCTTCAGCCCTGGCACCAACTTCAGCTCCAGCTCCAGCCAACTCATCCCCGACCGCCCCAGCCAACTCAACCCCAACTGCCCCAGCCAGTTCAGCCCCAGTCCCAACTCCAGCCTCACTCCCAGCCCAAGCCCCACTCCCAGCCCCGTCTCCAGCCCTAGTCAGTGTCCCAGGTCCCACCGCCTCAGCCCAAACTCAGGGACAGACTCACAAACCAGTCCAGAGTCCACTACAGACTTCAGCACAGCCTCCAAAACAGCCACCACCTTCAATTAGACTACCTTCAGCCCAGACACCTAATGGCACAGATTATGTAGCCACAGGAAAGGCCATCCAGACCTCACAGTCACATGGCACTCTAGCAACTGAACTGTGGGATAACAAGGTGGCCCCACCAACTGTGCTGAATGACATCTCAAAGAAATTAGGTCCCATTAGCCCACCACAGCCGCCTTCGGTCAGTGCCTGGAACAAGCCTCTAACGTCGTTTGGATCAGCTGCTTCATCAGAGGGAACAAAGAATGGTCAAGAAAGTGGAGTTGAAATTGGAATTGACACAATTCAGTTTGGTGCTCCAGCTTCAAACGGGAATGAAAACGAAATTGTTCCTGTGCTTTCAGAAAAAACTACTGACAAAATACCCGAACCTAAAGAACAACGGCAGAAGCAGCCACGGGCAGGCCCTATCAAAGCCCAGAAGCTTCCGGATTTGAGTCCAGTAGAAAACAAAGAGCATAAACCTGGTCCTATTGGAAAGGAACGATCATTAAAAAATAGAAAAGTAAAAGATGCCCAACAAGTGGAACCGGAAGGACAAGAGAAACCAAGCCCCACTGTCGTCAGAAGTGCAGATCCTGTGACAGCAAAGGAAACCAAAGCAGCTTCCGAAATGTCTGCTGAGATAGGAACAATGATCTCGGTGTCATCTGCAGAGTATGGCGCTAACGTGAAGGAGTCTGTAACAGACTATACTACACCTTCCTCTTCTCTGCCTAACACTGTGGCTACTAATAATGCAAAGATGGAGGATTCTTTGGTTAATAATGTGCCCCTGCCCAACACCCTTCCCCTCCCTAAGAGGGAGACTCTACAACAGAGCTCCAGCCTAACTTCAGTTCCTCCCACTACTTTCAGCCTCACCTTCAAGGTACGTACGCTCTCATCTCTAAGGGTCCTGGAGTACTGCATGCAAGGGGAC