Transcript asmbl_12739

Sequence
Transcript Sequence for observation asmbl_12739 of TGE0014713:
CGGGAGAGGGACGAAAAAAAAAATGCCGACGTGAGTGCGCAGGCCGCCGCCAAGGCCGGTGACAGCGGGTCCCCGCCGAAGCGGGACGTGGCCAAGCGCAGTTTCTCCAGTCAGAGGCCCGGCGTGGACCGCCAGAACCGGCGCGGCAACGGCGGCCCCCCCAAGCCCGGCAGGAACTTCTCGGGTCCCAGGAGCGACAGGAGAAGCGGCCCGCCCCCCAAGGGCGGGAAGCGCGGGCCGTTTGATGACCAGTCTGCAGGCACAGCGGGCGTCGACCCTCCCAGTGGCAGCTCCGCACACCATCAGGAGGGAGCACCTAATGGGACAGGACAGAAGAACAATAAAGATTCTGCAGGGAAAAAAAGAGAAGACCCCAAGCCAGGCCCTAAGAAACCCAAAGAGAAAGTGGATGCACTGTCACAGTTCGATCTCAACAATTATGCAAGTGTTGTTATAATTGACGACCATCCTGAAGTGACAGTAGTTGAAGACCCACAGTCAAATTTGAATGATGACGGTTTTACTGAAGTGGTATCCAAAAAACAACAGAAGCGTTTACAGGATGAGGAACGCCGGAAGAAGGAAGAACAGATCATACAGGTCTGGAACAAAAAGAATGCGAATGAAAAAGGACGAAGTCAGACTTCTAAGCTTCCTCCAAGATTTGCGAAAAAGCAGGCTACAGGGACCCAGCAAGCACAGTCTCCATCTGCAGCTCTGGCCACAGCTCCAGGTCCAGCCTCAGCCGCAGTCCTAACCTCACCCTCCACGCCACTACCAACGTCAGCCTCGGTGCCAGTGCCAGCTTCCACCTCAGCTACCACCCCCTCTTCTTCAGTTCCAGCTCCAACCCCCATCCTTGCCTCAGCTTCGACCCCAGCCTCTGTCCCCATCCTGACCTCAGCCTCAATTCCCATCCTTGCTTCAGCCCTGGCACCAACTTCAGCTCCAGCTCCAGCCAACTCATCCCCGACCGCCCCAGCCAACTCAACCCCAACTGCCCCAGCCAGTTCAGCCCCAGTCCCAACTCCAGCCTCACTCCCAGCCCAAGCCCCACTCCCAGCCCCGTCTCCAGCCCTAGTCAGTGTCCCAGGTCCCACCGCCTCAGCCCAAACTCAGGGACAGACTCACAAACCAGTCCAGAGTCCACTACAGACTTCAGCACAGCCTCCAAAACAGCCACCACCTTCAATTAGACTACCTTCAGCCCAGACACCTAATGGCACAGATTATGTAGCCACAGGAAAGGCCATCCAGACCTCACAGTCACATGGCACTCTAGCAACTGAACTGTGGGATAACAAGGTGGCCCCACCAACTGTGCTGAATGACATCTCAAAGAAATTAGGTCCCATTAGCCCACCACAGCCGCCTTCGGTCAGTGCCTGGAACAAGCCTCTAACGTCGTTTGGATCAGCTGCTTCATCAGAGGGAACAAAGAATGGTCAAGAAAGTGGAGTTGAAATTGGAATTGACACAATTCAGTTTGGTGCTCCAGCTTCAAACGGGAATGAAAACGAAATTGTTCCTGTGCTTTCAGAAAAAACTACTGACAAAATACCCGAACCTAAAGAACAACGGCAGAAGCAGCCACGGGCAGGCCCTATCAAAGCCCAGAAGCTTCCGGATTTGAGTCCAGTAGAAAACAAAGAGCATAAACCTGGTCCTATTGGAAAGGAACGATCATTAAAAAATAGAAAAGTAAAAGATGCCCAACAAGTGGAACCGGAAGGACAAGAGAAACCAAGCCCCACTGTCGTCAGAAGTGCAGATCCTGTGACAGCAAAGGAAACCAAAGCAGCTTCCGAAATGTCTGCTGAGATAGGAACAATGATCTCGGTGTCATCTGCAGAGTATGGCGCTAACGTGAAGGAGTCTGTAACAGACTATACTACACCTTCCTCTTCTCTGCCTAACACTGTGGCTACTAATAATGCAAAGATGGAGGATTCTTTGGTTAATAATGTGCCCCTGCCCAACACCCTTCCCCTCCCTAAGAGGGAGACTCTACAACAGAGCTCCAGCCTAACTTCAGTTCCTCCCACTACTTTCAGCCTCACCTTCAAGATGGAGTCTGCGCGTAAGGCGTGGGAAAATTCTCCCAACGTGAGGGAGAAGGGCTCTCCGGTGGCCTCTGCAGCGCCCCCCGTCGCCAGCGGCGTCAGCAGCGGCGCCAGCGGCCCGGGCACGGCCAGTTACAGCTCATTCTCCAGCGCGTCGGTGCCGCAGATCCCCGTCGCTTCGGTCACTCCTACGACATCGCTGTCAGGTGCTGGTACATACACTACCTCTTCTCTGAGTACAAAGTCCACAACCACGTCAGACCCGCCTAACATCTGTAAAGTGAAGCCCCAGCAGTTGCAGACAGGCAGCCTGCCCTCCGCCAGCCACTTCTCGCAGCTGAGCTGTGTGCCCTCCCTGATGGCCCAGCAGCAGCAGAGCCCACAAGTCTACGTGTCGCAGTCGGCAGCAGCTCAGATCCCAGCTTTCTACATGGACACCAGTCATTTATTCAATACCCAGCATGCACGATTGGCTCCACCATCGTTGGCCCAGCAACAAGGCTTCCAGCCAGGTCTTTCTCAGCCAGCTTCAGTTCAGCAGATCCCCATCCCTATCTACGCGCCGCTGCAAGGACAGCATCAGGCCCAGCTGAGCCTGGGCGCCGGACCGGCCGTCTCCCAGGCCCAGGAGTTATTCGGCTCGTCCCTCCAACCGTATAGATCTCAGCCAGCCTTCATGCAGAGCAGCCTGTCCCAGCCGTCTGTGGTCCTCTCTGGCACCGCCATCCACAGTTTCCCAGCTGTCCAGCACCAGGAACTTGCCAAGGCGCAGTCGGGCCTTGCCTTTCAGCAGACTTCAAATACTCAGCCCATTCCTATACTGTATGAACATCAGCTAGGCCAGGCATCGGGCCTGGGAGGGTCCCAGCTCATCGACACACATCTCCTCCAGGCTAGAGCAAATCTTACCCAGGCTTCAAATCTTTATTCCGGACAAGTACAGCAGCCTGGTCAGACAAATTTTTATAACACTGCCCAGTCACCGAGTACTCTCCAGCAGGTTACAGTGCCTCTGCCAGCATCCCAGCTCTCCTTGCCTAATTTTGGATCCACGGGGCAGCCGTTGATTGCTCTGCCCCAGACTCTGCAGCCCCCGTTACAGCACACCACCCCCCAGGCGCAGGCCCCCAGCCTGAGTCGGCCGGCACAGGTCAGCCAGCCTTTCAGAGGATTGATCCCCGCGGGAACACAGCACAGCATGATCGCGACCACCGGCAAAATGTCCGAAATGGAACTGAAAGCCTTTGGAAGTGGCATCGACATGAAACCAGGCACACCTCCCATCAGCGGCAGAAGCACCACACCCACCTCTAGTCCCTTCCGGGCCACGTCCACCAGTCCCAGCAGCCAGTCCAGCAAAATGAACAGCATCGTCTATCAGAAGCAGTTCCCGTCGGCCCCCGCCGCTGTGAGAATGGCACAGCCTTTTCCCACACAGTTTGCACCCCAGGCAAAGCAGAGAGCAGAGGTGCTTCAGTCCACGCAGCGGTTCTTCTCTGAGCAGCAGCAGAGCAAACAGATAGGAGGCAAAGCCCAGAAAGTGGACAGTGATTCAAGCAAGCCTCCTGAAACGCTGACCGACACTCCTGGTGTCTGTCAGGAAAAAGCAGAAGAAAAGCCACCCCCCGCGCCCGCCATAGCCACCAAACCTGTTAGAACTGGACCAATCAAACCTCAGGCGATCAAAACCGAAGAAACAAAATCTTAAAAGGCTGTGGTTTATTCCGGGGGGGCTGGGGGCGGGGAGAGGGGAAAG