Transcript asmbl_12370

Sequence
Transcript Sequence for observation asmbl_12370 of TGE0014703:
GGGGCAGTGGCGGCGGCGGGAAGCGGAGCCGGGACCGGGGGCGGAACCGCGGCCGGAGGCACCGAAGGGGGCAGCGCCGAGTCGGAGGGGGCGAAGATCGATGCCAGCAAGAACGAGGAGGATGAAGGCCATTCAAACTCCTCCCCACGACACTCTGAAGCAGCGACGGCACAGCGGGAAGAATGGAAAATGTTTATAGGAGGCCTTAGCTGGGACACTACAAAGAAAGATCTGAAGGACTACTTCTCCAAATTTGGTGAAGTTGTAGACTGCACTCTGAAGTTAGATCCTATCACAGGGCGATCAAGGGGTTTTGGCTTTGTGCTATTTAAAGAGTCGGAGAGTGTAGATAAGGTCATGGATCAGAAAGAACATAAATTGAATGGGAAAGTGATTGATCCTAAAAGGGCCAAAGCCATGAAAACAAAAGAGCCTGTTAAAAAAATTTTTGTTGGTGGCCTTTCTCCAGATACACCTGAAGAGAAAATAAGAGAGTACTTTGGTGGTTTTGGTGAGGTGGAATCCATAGAGCTCCCCATGGACAACAAGACCAATAAGAGGCGTGGATTCTGCTTTATTACCTTTAAGGAAGAGGAACCAGTAAAGAAGATAATGGAAAAGAAATACCACAATGTCGGTCTTAGTAAATGTGAAATAAAAGTAGCCATGTCGAAGGAACAGTATCAGCAACAGCAACAGTGGGGATCTAGAGGAGGATTTGCAGGAAGAGCTCGTGGAAGAGGTGGTGGCCCCAGTCAAAACTGGAACCAGGGATATAGTAACTATTGGAATCAAGGCTATGGCAACTATGGATATAACAGCCAAGGTTACGGTGGTTATGGAGGATATGACTACACTGGTTACAACAACTACTATGGATATGGTGATTATAGCAACCAGCAGAGTGGTTATGGGAAAGTATCCAGGCGAGGTGGTCATCAAAATAGCTACAAACCATACTAAATTATTCCATTTGCAACTTATCCCCAACAGGTGGTGAAGCAGTATTTTCCAATTTGAAGATTCATTTGAAGGTGGCTCCTGCCACCTGCTAATAGCAGTTCAAACTAAATTTTTTGTATCAAGTCCCCGAATGGAAGTATGACGTTGGGTCCCTCTGAAGTTTAATTCTGAGTTCTCATTAAAAGAAATTTGCTTTCATTGTTTTATTTCTTAATTGCTATGCTTCAGAATCAATTTGTGTTTTATGCCCCTCCTCCCCAGTATTGTAGAGCAAGTCTTGTGTTAAAAGCCCAGTGTGACAGTGTCATGATGTAGTAGTGTCTTACTGGTTTTTTAATAAATCCTTTTGTATAAAAATGTATTGGCTCTTTTATCATCAGAATAGGAAAATTTGAGGAATATGAAATTTTTTGTCATGGATTTAAGTTTAGTAGAAGCATAAATTTGGAAAATAGTAAACCTTGTCTAAATTGAGGACATGGTTAAGATTGCAGTGAAATTTTAGTGTTTTTAGTAAAAATCTAATTTTTGCCACAATGTGACCTCCCTGTCCAAATTGGAAATT