Transcript asmbl_12358

Sequence
Transcript Sequence for observation asmbl_12358 of TGE0003627:
GCTGCGGCTGCCACGTTGAAGCGGAACGTGGAGGTGGCCCTGGGCCGGGAGGAGGGGCGGCGGCGAATGCTGGAAGAGTCTGACGGGCGCCGAGCTAACGCAGGAACCGGTAGCCTGGGGTCCTCGCCAGGATGAAGTTAAAGGAAGTAGATCTTACGGCCATGCAGGCATGGAGCCCTGCCCAGAATCATCCCATTTACCTAGCTACAGGAACATCTGCTCAGCAGTTGGATGCAACATTTAGTACTAATGCTTCCCTTGAGATATTTGAATTAGACCTTTCTGATCCATCCTTGGATATGAAATCTTGTGCCACTTTCTCTTCTTCTCACAGGTACCACAAGTTGATTTGGGGTCCTCATAAGGTGGATTCCAAGGGAAATATCTCTGGAGTTCTGATTGCAGGTGGTGAAAATGGAAATATTATTCTTTATGATCCTTCTAAAATTATAGCTGGAGACAAGGAAGTAGTGATTGCCCAGAATGACAAACATACCGGCCCAGTGAGAGCCTTGGATGTGAACATTTTCCAGACTAATCTGGTAGCCTCTGGTGCTAATGAATCTGAAATCTACATTTGGGATCTAAACAATTTTACAGCTCCAATGACACCAGGAGCCAAAACACAGCCCCCAGAAGATATCAGCTGCATTGCGTGGAACAGACAAGTTCAGCATATTTTAGCATCAGCCAGTCCCAGTGGCCGGGCCACTGTATGGGATCTTAGAAAAAATGAACCTATCATTAAAGTCAGCGATCATAGTAACAGGATGCATTGCTCTGGGTTGGCGTGGCATCCTGATGTTGCTACTCAGATGGTCCTTGCATCTGAGGATGATAGGTTACCAGTGATCCAGATGTGGGATCTTCGCTTTGCCTCCTCTCCACTTCATGTCCTGGAAAACCATGCCAGGGGAATTTTAGCAATTGCTTGGAGCATGGCAGATCCTGAATTGTTGCTCAGCTGTGGAAAAGATGCTAAGATTCTCTGCTCCAACCCAAACACAGGAGAGGTATTATATGAACTTCCCACCAATACACAGTGGTGCTTTGATATTCAGTGGTGTCCCAGAAATCCTGCTGTCTTATCAGCTGCTTCCTTTGATGGGCGTATCAGTGTTTATTCTATCATGGGAGGGAGCACAGATGGTTTAAGGCAGAAACAAGTTGACAAGCTTTCATCATCTTTTGGGAATCTTGATCCCTTTGGCACAGGACAGCCCCTTCCTCCATTACAAATTCCTCAGCAGACTGCTCAGCATAGCATAGTATTGCCTCTTAAGAAGCCACCTAAGTGGATCCGAAGGCCTGTTGGTGCTTCTTTTTCGTTTGGAGGCAAACTGGTTACCTTTGAGAATGTCAAAATGCAGTCTCAGCAGGGAGCTGAGCAGCAGCAGCTGCAGCAACACGTGTTCATTAGTCAGGTTGTAACAGAAAAGGAATTCCTCAGTCGATCGGACCAGCTTCAGCAGGTTGTACAGTCACAAGGATTTGTCAATTATTGTCAGAAGAAAATTGATGCTTCTCAGACAGAGTTTGAAAAAAATGTGTGGTCCTTTTTGAAGGTAAACTTTGAGGATGATTCTCGTGGAAAATACCTTGAACTTCTAGGATACAGAAAAGAAGACCTGGGAAAGAAGATTGCTTTGGCCTTGAACAAAGTGGATGGACCCGATGTGCGTATTAAAGAGGAAAAACAAGAATTAGAATTTCTCCCGTCAGCTAGAGGAACATTTAACATCTCCATCAGCGGGGATATTGATGGTTTAATCACTCAGGCTTTGCTGACGGGTAACTTTGAGAGTGCTGTTGACCTTTGTTTACATGATAACCGCATGGCTGATGCCATTATATTGGCAATAGCAGGTGGACAAGAACTCTTGGCTCGAACCCAGAAAAAATACTTTGCAAAATCCCAAAGCAAAATTACCAGGCTAATTACTGCAGTAGTGATGAAGAACTGGAGAGAGATTGTTGAGTCTTGTGACCTTAAAAATTGGAAAGAGGCTTTAGCTGCAGTATTGACTTATGCTAAACTTGATGAGTTTTCAGCCCTTTGTGATCTTTTGGGAACCAGGCTTGAAAGTGAAGGTGATAGCCTCTTGCAGACTCAGGCCTGTCTCTGCTATATTTGTGCAGGGAATGTAGAGAAATTAGTTGCATGTTGGACTAAAGCTCAAGATGGGAGCAACCCCTTATCCCTTCAGGATCTGATTGAGAAAGTCGTCATCCTACGAAAAGCTGTACAACTCACACAAGCTGTGGACACTAACGCCGTAGGAGTTCTTTTGGCTGAGAAAATGAGTCAGTATGCCAACTTGTTGGCAGCCCAGGGCAGTATTGCTGCAGCCTTGGCTTTTCTTCCTGAAAGTACCAACCAGCCAAATATTGTGCAGCTTCGTGACAGACTTTATAAAGCACAAGGAGAGCCTGTACCAGGACAGGAATCAACTAAAGTTCCTTATGAGAGGCAGCAGCTGCCTAAGGGCAGGCCTGGACCAATTGCTGGCCACACACAGATGCCGAGAGTTCCAACTCAACAATATTATCCCCATGGAGAAAATCCTCCACCTCCAGGTTTCTTAGTGCATGGAAATGTTAATCCAAACGTTGCTGCAGCTCAGCTTCCCACATCTCCAGGTCATATGCATACCCAGGTACCACCTTATCCACAGCCACAGCGTCCTCAGAATGGTTGGAATGATCCTCCAGCTTTGAACAGAGTACCCAAGAAGAAGAAGATGCCTGAAAACTATATGCCACCTGTTCCCATCACATCACCAATCATGAACCCCTTGGGTGACCCCCAGTCACAGATGCTGCAGCAGCAGCCTTCAGCTCCAGTACCACTGTCCAGCCAAGCTTCATTCCCACCGTCACATCTTCCAGGTGGCCAGCCCTCCTTCCATGGCATACCCCTTGGTCAACCAGGCATGCCACCATCTTTCTCAAAGCCCAATATCGAAGGTGCCCCAGGGGCTCCTATTGGAAATACCATTCAGCATGTGCAGTCTTTGCCAACAGAAAAAATTACCAAGAAACCTATTCCAGATGAACACCTCATTCTGAAGACCACATTTGAGGATCTTATTCAGCGCTGCCTCTCTTCAGCCACAGATCCCCAAACCAAGAGGAAACTAGATGATGCCAGCAAACGCTTGGAGTTTCTATATGATAAACTTCGGGAACAGACACTTTCACCCACAATCATCAGTGGTTTACACAACATTGCAAGGAGCATTGAAACGCGAAACTACTCAGAAGGATTGACCACCCATACCCACATAGTTAGCACCAGCAACTTCAGCGAGACCTCTGCTTTCATGCCAGTTCTCAAAGTTGTTCTCACCCAGGCCAATAAGCTGGGTGTCTAAAAGGACAGGTTTACTCGCAGCCATATTGCCATTTTCCAAAAGAAACATGTTTTAAAAAATGATAAGATATGGACCAATTCTCATTAGCATGTTTCCATAGCTGCCAGTCAAGAGCATTTACACTATTTCTGCAGATATATTCATTTTAGAACTGCTATAAACCCTGGTGCTTTCTTTTGTTTTAATCTTTTATTGCCCATGATGATTTTCCTATTCTGCAAATAATGTATTTCCTGGATTACACATAATATGTTTTCCTCAAGTATTCCGATAAAATATGGTTTTTAAAACCGTAGTGTACTTTTTGGAAAAGGAGCATCTGGTTATGCATAAAGCTGAGCTAAAACTAAATTTCTTTCATGTCCTCTCTCTCTCTTCTGTGTCAATCAGATTAAAGTGTGTAATCCTATTTTAAGTGTATGTAGT