Transcript asmbl_12289

Sequence
Transcript Sequence for observation asmbl_12289 of TGE0003620:
GGGAGGAAGGGCAGGAGGAAGGGGTGCGGTCGCAGTCGCGGTCACGGTCGCGGGCCGGGAACGAGCTCCGAACACCAGCCCGCGAGGCCGCACACCTGTCTGGCTGTTCTGCCGCACACCAGTCCCCGCAGCCTCGCTTCAGGGTTAGTGTGACCTGAACTTAAGGCAAAGGTGGTATATCATGGCATCTCTCTGGGTTGGACACCGAGGGACAGTGCGAGATTATCCAGGCTGTAGCCCATCAGTGGATGCTGAAGCGATTCGTAAGGCAATCAGAGGAATTGGAACTGACGAGAAAACACTCATCAGCATTCTAACTGAGAGGTCAAACGCACAGCGGCAGCTGATTGTTAAGGAATATCAAGCAGCGTATGACAAGGAACTGAAAAATGACTTGAAGGGCGACCTCTCTGGCCACTTTGAGCATCTCATGGTGGCCCTCGTGACTCCTCCAGCAGTGTTTGATGCGAAGCAGCTGAAGAAATCCATGAAGGGCACTGGAACAAATGAAGATGCATTGATTGAAATCTTAACCACCAGGACAAGCAGGCAGATGAAAGAGATCTCTCAAGCCTACTACACAGTATATAAGAAGAGTCTTGGAGATGACATTAGTTCTGAAACATCTGGTGACTTCCGGAAAGCTCTGTTGACTTTGGCAGATGGCAGAAGAGATGAAAGTCTGAAAGTAGATGAGCATTTGGCCAAAAAAGATGCCCAGATTCTCTATAATGCTGGTGAGAACAGATGGGGCACGGACGAAGATAAATTCACTGAGATCCTATGTTTAAGGAGCTTTCCTCAACTAAAACTAACATTTGATGAATACAGAAATATTAGCCAGAAGGACATTGAGGACAGCATAAAAGGAGAATTATCTGGGCATTTTGAAGATTTGCTGCTGGCCATAGTTCATTGTGCAAGGAATATGCCTGCCTTTTTAGCTGAAAGACTACATCAAGCTTTGAAGGGTGCTGGAACTGATGAGTTCACTCTGAACCGAATAATGGTTTCCAGATCAGAAATTGACCTTTTGGACATTCGAGCAGAGTTTAAGAAGCAGTATGGCTACTCCCTAAATTCAGCAATTAAATCGGATACTTCTGGAGACTATGAAATCACACTCTTAAAGATCTGTGGAGGAGATGACTGAGTCAAGAACATCATCTCCAAAGGTTGTTTGCTTCCATGATGGGCTTCTCCAACAGCTCTGCTTACTTCTCTTTCACGGGATTTAAAAGTACAAGAAGTATAAACAGCAATCTGTTTTTCGTAACAGAAATTGTCATTGTTCCATAACAACAACAAAGTGATTATCTTAAAGTATTTCATCATAATGTAGTAGTTTATAAGTGAAAATTTAAAATGGTATAAAGAATCCGCTAATACTCTCCAAATTATATTTCTACTTAGGAAGTGAGAATCATTGTACAGTTCTAAAACATTAAATGCAAAAACAAGGTAATAAAAGTTGTCACCTTTGTTAAA